ID: 1090105478

View in Genome Browser
Species Human (GRCh38)
Location 11:123850628-123850650
Sequence CTAGTTCTCCAGCAATAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090105478_1090105482 9 Left 1090105478 11:123850628-123850650 CCAATTTATTGCTGGAGAACTAG No data
Right 1090105482 11:123850660-123850682 TGGAAGGTCAGAAGACACTCTGG No data
1090105478_1090105481 -7 Left 1090105478 11:123850628-123850650 CCAATTTATTGCTGGAGAACTAG No data
Right 1090105481 11:123850644-123850666 GAACTAGTGTGGTTGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090105478 Original CRISPR CTAGTTCTCCAGCAATAAAT TGG (reversed) Intergenic
No off target data available for this crispr