ID: 1090109003

View in Genome Browser
Species Human (GRCh38)
Location 11:123884566-123884588
Sequence CAGGATTAAGTTAAGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090109003 Original CRISPR CAGGATTAAGTTAAGGAGGA AGG Exonic
905898309 1:41563439-41563461 CAGGAAAAAGTCAGGGAGGAGGG - Intronic
906288265 1:44602628-44602650 CGGGAGTCAGTGAAGGAGGAGGG - Intronic
908585912 1:65568072-65568094 CAGGAGTTAGGTAAGAAGGAGGG - Intronic
912114406 1:106387314-106387336 CAGGATTAAGTTCAGGACACTGG - Intergenic
914681484 1:149941695-149941717 CAGGACTGAGATTAGGAGGAGGG - Exonic
915702285 1:157807304-157807326 CAGGGGTAAGATAAGGAGGGAGG - Intronic
917929411 1:179813312-179813334 CAGGCGTAAGTCAAGGAGGATGG + Intronic
918093601 1:181317320-181317342 AAGGATCAAGTTAAGGGGGAAGG - Intergenic
919150933 1:193697486-193697508 AAGGATTAAATTATGGAGGCTGG - Intergenic
920278211 1:204824290-204824312 CAGCATTAAGGGAAGGAGGGAGG - Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
922040182 1:221888802-221888824 TAGGATCCAGGTAAGGAGGATGG + Intergenic
922273206 1:224053344-224053366 CAAGATGAATTTAAGGAAGAAGG - Intergenic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
923230521 1:231982336-231982358 AAGGAGAAAGGTAAGGAGGAAGG - Intronic
924068499 1:240252203-240252225 CAGAAATCAGTTAAGGAGGCCGG - Intronic
1062765899 10:64546-64568 TAGGTTTAAGTTATGGAGAAGGG - Intergenic
1064371489 10:14755571-14755593 CAGGATTAAATTGAGGATGATGG - Intronic
1065246182 10:23760462-23760484 CAGGAATAAGCAAAGCAGGAGGG + Intronic
1066015628 10:31240766-31240788 CAGGACTAAGATAAGGATGCAGG + Intergenic
1067492365 10:46722880-46722902 AAGGTTTAAAGTAAGGAGGATGG - Intergenic
1067602300 10:47617502-47617524 AAGGTTTAAAGTAAGGAGGATGG + Intergenic
1068878384 10:62022354-62022376 CAGGAGGAAGATAAGGGGGAAGG + Intronic
1069070648 10:63987772-63987794 CAGGATTAAGGGAACAAGGAGGG + Intergenic
1071033400 10:81212774-81212796 CAGTATTAAGCAAAGGAGGAGGG - Intergenic
1071653652 10:87422914-87422936 AAGGTTTAAAGTAAGGAGGATGG + Intergenic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1071892874 10:90031085-90031107 TAGTATTAAGTTAAATAGGAGGG - Intergenic
1072184827 10:93026934-93026956 AATGATTAACTTAATGAGGAAGG + Intronic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073205744 10:101768465-101768487 CAGAATTAATTAAAGGGGGAAGG + Intergenic
1074770976 10:116733582-116733604 CAGGAGTAAGTTCTGTAGGATGG - Intronic
1074881728 10:117664944-117664966 CAGGATTAAGTGGAGGGAGAGGG - Intergenic
1077739121 11:4825649-4825671 CTGGATGAAGTTCAGGTGGAAGG - Intronic
1080312051 11:30905851-30905873 CAGGATTAGGGAAGGGAGGAGGG + Intronic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1082276174 11:50223903-50223925 CAGAATTATGTTAACGAGGCGGG + Intergenic
1083058053 11:59842250-59842272 GAGGAGTAAGTGAAGGAAGAGGG - Intronic
1086322851 11:85668625-85668647 CAGGAATAAGATAAGGAAGTTGG - Intronic
1087092632 11:94289688-94289710 CATGATTAAGTTTAGCTGGATGG + Intergenic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1087601436 11:100321265-100321287 TAGGAATAAGTTAAGCAAGAAGG - Intronic
1087860347 11:103145442-103145464 CAGCATTAAGTCAAAGAAGATGG - Intronic
1089425703 11:118372763-118372785 CTGGTATAAATTAAGGAGGAGGG + Intronic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1090452048 11:126815231-126815253 CTGGATTGAGTTAAGGATGGGGG + Intronic
1091990584 12:4952481-4952503 ATGGTTTAAGTTGAGGAGGAAGG + Intergenic
1092061948 12:5558160-5558182 CAGGAGGAAGATAAGGGGGACGG - Intronic
1092663731 12:10770223-10770245 CAGGATTAAGATAATGACCAAGG + Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1097765906 12:63526290-63526312 CAGCAGTAACTTACGGAGGAAGG - Intergenic
1098177334 12:67806308-67806330 CACTACTAATTTAAGGAGGATGG + Intergenic
1099566727 12:84258500-84258522 CAGGAATAATTTAACGAAGAAGG - Intergenic
1104147010 12:126044322-126044344 CAGGATGAAGTCAAGAAGGAAGG + Intergenic
1104640681 12:130465056-130465078 TAGGATTATTTTATGGAGGAAGG + Intronic
1106009553 13:25806154-25806176 CAGGGGTAAGTTGAGGAGGCGGG + Intronic
1106987776 13:35375513-35375535 CATAATTCAGTTAAGGTGGAAGG - Intronic
1110261543 13:73490783-73490805 CAGGATGAAGTCAAGAGGGATGG + Intergenic
1111419371 13:87991259-87991281 CAGAATTAAGTTAAGGTATAAGG + Intergenic
1112600426 13:100850099-100850121 CATGATTAAGTTAAGGACCTTGG - Intergenic
1114158904 14:20140455-20140477 CAAGATAAAGTGAATGAGGAAGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115840430 14:37463282-37463304 CATGATTAAGTTACGGGGGTGGG - Intronic
1116051112 14:39804382-39804404 GAGGATGGAGTCAAGGAGGAGGG + Intergenic
1116256431 14:42562316-42562338 CAGGAGGAAGGTAAGGAGGAAGG - Intergenic
1116744924 14:48805698-48805720 CAGGATAAAGTTATGGCTGAAGG - Intergenic
1116974856 14:51104889-51104911 CAGGACTAAGTTAGGCAAGAAGG + Intergenic
1119603891 14:75997977-75997999 CAGGACTAAGTTAAGGATTTGGG - Intronic
1120019660 14:79514396-79514418 CAGGACTAAGTTGAGGAAAATGG - Intronic
1121657183 14:95605616-95605638 CAGGAGTTATCTAAGGAGGAAGG - Intergenic
1125106165 15:35973993-35974015 CAGATTGAAGTTAAGGAGGGAGG - Intergenic
1126640429 15:50819186-50819208 CAGCAGTAAGGAAAGGAGGATGG - Intergenic
1131443405 15:92475853-92475875 AATGGATAAGTTAAGGAGGAAGG - Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132879083 16:2153371-2153393 CATGATTACGTTAAGAGGGAGGG + Exonic
1133367656 16:5223724-5223746 CAGGATTCTGATGAGGAGGAAGG + Intergenic
1134097645 16:11429266-11429288 CAGGATTAAGAGAAAGAGGGGGG - Intronic
1135860724 16:26053493-26053515 CAGAATTAAGTTCAGAATGAAGG + Intronic
1136634258 16:31509329-31509351 CAGGATTAAGTCCACGAGGAAGG - Intergenic
1139329534 16:66176642-66176664 CATGATGAAGTGATGGAGGAAGG + Intergenic
1139352001 16:66342786-66342808 AAGGAATTTGTTAAGGAGGATGG - Intergenic
1140136511 16:72210576-72210598 CAGGAGTAATTAAAGCAGGAGGG - Intergenic
1141562647 16:84879769-84879791 CAGGATTATGGGAAGGAAGAAGG - Intronic
1141840448 16:86570988-86571010 GAGGAGGAAGTTAAGGAGGTAGG + Intergenic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143177916 17:4967197-4967219 CTGGGTTAAATTAAGCAGGAGGG + Intronic
1144114744 17:12077066-12077088 CAGGAATGAGTTCAGGAGAACGG + Intronic
1144422347 17:15109916-15109938 CAGGATGAGGTTGAGGAGGTGGG - Intergenic
1145893506 17:28436354-28436376 AAGAAGTAAGTCAAGGAGGAAGG - Intergenic
1147956968 17:44141516-44141538 CAGTATTAAGTCAAGCAGGGAGG + Intergenic
1148233497 17:45951875-45951897 CAGGATTGAGGAAAGGAGAAAGG + Intronic
1149401481 17:56300882-56300904 CAGGATTTGATTAAGGTGGAGGG - Intronic
1151021003 17:70617488-70617510 AAGGATTAAGGTGAGGTGGATGG - Intergenic
1152958769 18:64135-64157 TAGGTTTAAGTTATGGAGAAGGG - Intronic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1156217756 18:35017851-35017873 CAGTATTATGTTAAATAGGAGGG + Intronic
1157171209 18:45407606-45407628 CATGATTAAGTTTTTGAGGATGG - Intronic
1158996287 18:62923494-62923516 CAGGATTATGTGAAGGGGGTGGG + Intronic
1159082383 18:63750146-63750168 CACCATTAAGTAAAGGAAGAGGG - Intergenic
1163412554 19:17164845-17164867 CAGAATTAAGTTGTGCAGGAAGG + Intronic
1165991152 19:39814973-39814995 CAGAATAGAGTCAAGGAGGAAGG + Intergenic
1166373574 19:42315209-42315231 GAGGATGAAGATGAGGAGGAAGG - Exonic
925807705 2:7667624-7667646 CTGGGTTAAGTCATGGAGGAAGG - Intergenic
926267110 2:11333852-11333874 CAGAAAAAAGTTAAGGAGAAGGG + Intronic
928546979 2:32337459-32337481 CAAGATGAGGTTCAGGAGGAGGG - Intergenic
928965665 2:36972368-36972390 CAGTATTAAGTTAGGAATGAAGG + Intronic
930792174 2:55345307-55345329 CAGTATTAGGATAAGAAGGAGGG - Intronic
931900337 2:66781393-66781415 AAGGAGCAAGTTAAGGAGGGAGG + Intergenic
934144470 2:89078071-89078093 CATGTTTAAAATAAGGAGGATGG - Intergenic
934224782 2:90122478-90122500 CATGTTTAAAATAAGGAGGATGG + Intergenic
935031513 2:99327369-99327391 TAGTATTAAGTTAAGCAGGCAGG - Intronic
937468636 2:122156407-122156429 CCAGATTACGTTAATGAGGAGGG + Intergenic
937729444 2:125209932-125209954 CAAGATAAAGTAAAGGAGGCTGG + Intergenic
938723774 2:134089112-134089134 AAGGAATAATTTCAGGAGGAAGG - Intergenic
938984235 2:136557985-136558007 CAGGATTAAGGTGAAGAGGAAGG - Intergenic
939002677 2:136754633-136754655 CAGGAGTAAGTTGAGAAGCAAGG + Intergenic
940085821 2:149857438-149857460 CAGGATGAAGGTAAGTAGGGCGG - Intergenic
940583766 2:155616827-155616849 GAAGAATAAGTTATGGAGGAGGG + Intergenic
941234845 2:162958756-162958778 AAGGATAAATTTAAAGAGGAAGG - Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
942230047 2:173852493-173852515 CAGACTTCAGTTCAGGAGGAGGG + Intergenic
944850416 2:203713639-203713661 CAGGATTAAGAAAAAGTGGAGGG + Intronic
945986021 2:216354243-216354265 CAGGATTAGGCTGAGTAGGAAGG + Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946894842 2:224313035-224313057 GGGGATAAAGTTATGGAGGAAGG - Intergenic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1171107250 20:22445993-22446015 CAAAACAAAGTTAAGGAGGATGG + Intergenic
1171560637 20:26121861-26121883 CAGTAATAAGTTTAGGAGGTCGG - Intergenic
1173636927 20:44567734-44567756 CAGGATTAAGAACAGGAGCAGGG + Intronic
1174974314 20:55314504-55314526 CAGCAATGAGTTAAGAAGGAAGG - Intergenic
1175763247 20:61575282-61575304 CAAGTTTAAGTTGAGGAGAAAGG + Intronic
1176285820 21:5018967-5018989 CGGGATTAAATTGAGGTGGAAGG + Intergenic
1177091826 21:16779001-16779023 CAGCATAAAGTCAAGGAGGAAGG + Intergenic
1177363871 21:20108525-20108547 CAGGATTGAGTGAACAAGGATGG + Intergenic
1179425557 21:41275509-41275531 GACGATTAAGACAAGGAGGATGG - Exonic
1179520678 21:41942450-41942472 CAGGATTCAGTTATGGGAGAAGG + Intronic
1179871361 21:44244508-44244530 CGGGATTAAATTGAGGTGGAAGG - Intergenic
1181380390 22:22497656-22497678 CAGGGTGAAGTTAAGGGGAATGG + Intronic
1181976432 22:26734001-26734023 CATGATTAAGTTAAGGATCTAGG - Intergenic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1182466439 22:30519798-30519820 CAAGATTAATTTCAGGAGCAGGG + Intergenic
1183383876 22:37503984-37504006 CAGGCTTAAGATAAGGCCGATGG - Intronic
949095197 3:77363-77385 CAGGAGGAAGATAAGAAGGAGGG - Intergenic
952238884 3:31509348-31509370 GAGGATTAACTTAAGTAGCAGGG + Intergenic
953438217 3:42896658-42896680 CAGGATTAAGGGAATGAGGGGGG + Intronic
954721705 3:52569595-52569617 AAAGATTAATTTAGGGAGGATGG + Intronic
954982752 3:54761103-54761125 AAAGATGAATTTAAGGAGGAGGG - Intronic
956265514 3:67392157-67392179 CAGGGGTCAGTGAAGGAGGAAGG - Intronic
956277624 3:67520243-67520265 CAGGAAGAAGTAAAGAAGGAAGG + Intronic
958188577 3:90155080-90155102 AAAGATAAAGTTAAGGAGGGAGG + Intergenic
959967407 3:112372745-112372767 CAGGATTAAATTAAGTTGTATGG - Intergenic
963258935 3:143175091-143175113 CAGGATTAAGAGAACGAGCAGGG + Intergenic
964464950 3:156981650-156981672 TAGGATTAAGTTGAGGAGTATGG + Intronic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
967261727 3:187649155-187649177 CAGGATTTAGGAAAGGACGATGG + Intergenic
968175514 3:196546165-196546187 CAAGATACAGTTAAGAAGGAAGG + Intergenic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
970310385 4:14776723-14776745 TAGGCTTAAGCTAAGGGGGAAGG - Intergenic
971905905 4:32725653-32725675 CAGGAATAAGTTAAGGAACCAGG + Intergenic
972721716 4:41706217-41706239 CAGGATTTGGTGCAGGAGGAAGG + Intergenic
973537341 4:51896648-51896670 CAGGAGTAAGTTTGGGAGGCAGG - Intronic
974209585 4:58752673-58752695 CAGGATTAAGGTAAGGATTAAGG + Intergenic
976418681 4:84811549-84811571 CATGATTAAGTGCAGGAGTAGGG - Intronic
976456356 4:85251492-85251514 CAGGTTTAAGCTGAGGAGGTAGG + Intergenic
977178749 4:93846722-93846744 CAGGAAGAAGATAAAGAGGAGGG - Intergenic
977228038 4:94416997-94417019 CAGGAATAAGTTAAGGAGACAGG + Intergenic
977368492 4:96102964-96102986 CATGATTAAGGAAGGGAGGAAGG - Intergenic
980206629 4:129727508-129727530 TAGGAATAAGGTAAGGAAGAAGG - Intergenic
980462885 4:133139727-133139749 CAGGGTTAAGTTAAAAAGAAAGG - Intergenic
980507491 4:133741436-133741458 CAGGGTGAAGGTTAGGAGGAGGG - Intergenic
980707017 4:136511464-136511486 AAGGATTAAGCTAGTGAGGAAGG - Intergenic
980818553 4:137981399-137981421 AAGGCTTAAGTTTAGGAGGTAGG - Intergenic
981039746 4:140212225-140212247 CAGGATTATGTCAGGTAGGAGGG - Intergenic
981770678 4:148304259-148304281 AAGGATTGAGTTCAGGAGAAGGG + Intronic
983527420 4:168773399-168773421 CATGATTAAATAAAGGAGCATGG - Intronic
984078874 4:175216990-175217012 CAGGATTGAGTTATGGCTGAAGG - Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987562659 5:19543672-19543694 CAGAATTACAGTAAGGAGGAAGG + Intronic
987593591 5:19965705-19965727 CAGGTTACATTTAAGGAGGAAGG + Intronic
988401712 5:30770093-30770115 AAAGATTAACTTAAGGAGAATGG - Intergenic
988662105 5:33282047-33282069 CAAGGTGAAGTTAAGGAGGTTGG + Intergenic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
989692360 5:44159299-44159321 CAGGAGGAAGATAAGGGGGAGGG + Intergenic
989761208 5:45018892-45018914 AGGGATTAAGTGAAGCAGGAAGG - Intergenic
991325570 5:65427926-65427948 CATGATTAAGTTAATAAAGAAGG + Intronic
992574158 5:78094606-78094628 CAGAATAAAGTTATGGAGGAGGG - Intronic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993981005 5:94543719-94543741 TAGGATTAAGTTTAGGATTAAGG + Intronic
994903990 5:105812784-105812806 TATGATTAAGTTAGGGGGGAAGG - Intergenic
996228270 5:121029301-121029323 CAGAATTTAGTTGAGGATGAAGG + Intergenic
997799336 5:136844024-136844046 CTGGATCCAGTTAAGAAGGAAGG - Intergenic
1001185413 5:169567001-169567023 CAGGAATAGGTGAAGGTGGAAGG - Intergenic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1004137410 6:12980981-12981003 CAGGTTTATGTCAAGGAGAATGG - Intronic
1005938319 6:30541968-30541990 AAGGATCAAGTGAAGGAGAAAGG - Exonic
1006917460 6:37603594-37603616 CAGGAGTTAGTGAAGGGGGATGG - Intergenic
1008764434 6:54894098-54894120 GAGGCTTAACTTAAGGATGAGGG + Intronic
1009292648 6:61903530-61903552 AAGGATGAAGTCAAGGAGGCTGG + Intronic
1009476897 6:64103819-64103841 CAGGATCAAATTAAGAATGAGGG + Intronic
1009535695 6:64880627-64880649 CAGGATGAAGGTAAGGAGTTGGG - Intronic
1009984194 6:70763566-70763588 AAGGATTAAGCTAGTGAGGAAGG + Intronic
1010033554 6:71294528-71294550 CTGGATTGAGTTTGGGAGGAGGG + Intronic
1012949420 6:105502293-105502315 CAAGACTAAGTTAATGATGAGGG - Intergenic
1015731187 6:136349826-136349848 CAGGAGTAAGGTGAGGAGTAGGG + Intronic
1016928310 6:149376605-149376627 AAGGACTGAGTTAATGAGGAAGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1019688508 7:2396224-2396246 CAGGGTTCTGTTAATGAGGAAGG + Intergenic
1026159016 7:67852618-67852640 GAGGGATAAGTTGAGGAGGATGG + Intergenic
1026191665 7:68134121-68134143 CAGAATTATGTTAACGAGGCAGG + Intergenic
1027505158 7:79007734-79007756 CTAGATTTAGTTAAGTAGGATGG + Intronic
1028568144 7:92256023-92256045 TAGTATCAAGTTATGGAGGAAGG + Intronic
1028734970 7:94198404-94198426 CATGATTAAGTCAGGGATGAGGG - Intergenic
1029893603 7:103958108-103958130 AAGGATTAACTAAAGCAGGATGG + Intronic
1030246720 7:107390935-107390957 CAGGATAAAGTTATGGCTGAAGG + Intronic
1030335824 7:108324661-108324683 CAGGATTAGGTTTAGAAGAATGG + Intronic
1030901171 7:115125661-115125683 GTGGCTTAAGTTAAGGAGAATGG - Intergenic
1030984500 7:116225357-116225379 CAGTATTAAGTTAATGACAAAGG - Intronic
1031534566 7:122917235-122917257 CAGGGTTAAGATAAGGGGTATGG - Intergenic
1032246934 7:130221296-130221318 CAGGATTGAGTTAAGTATGGGGG + Intergenic
1032329270 7:130962540-130962562 CAGGAGGAAGATAAGGGGGAAGG - Intergenic
1032545524 7:132738482-132738504 CCTGATTAAGTCCAGGAGGATGG - Intergenic
1033212838 7:139472959-139472981 CAGGGTTCAGTTAAGGGTGAAGG + Intronic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1035590276 8:807844-807866 CAGGAATAAGGAAGGGAGGATGG + Intergenic
1035835005 8:2740607-2740629 CAGTACTATGATAAGGAGGAAGG - Intergenic
1036841973 8:12130915-12130937 TAGGATGATTTTAAGGAGGATGG + Intergenic
1037081654 8:14795106-14795128 CAGAATAAAGGTAAGTAGGAGGG + Intronic
1039802432 8:40970887-40970909 CAGGAAGAAGATAAGGTGGAAGG - Intergenic
1043112453 8:76203365-76203387 AAGGACTCAGTGAAGGAGGAAGG - Intergenic
1044111905 8:88285671-88285693 AAGGATTCAGTTGAGGGGGAGGG - Intronic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1051882518 9:21854428-21854450 CAGGATTATGTGAATGAGAAAGG + Intronic
1052371825 9:27674258-27674280 GAGGATTCAGTAAAGGAGGGGGG - Intergenic
1054741543 9:68811063-68811085 CTGCATTAAGTCTAGGAGGAAGG - Intronic
1056034525 9:82589800-82589822 CAGAATTAAGTTTGGGAGGGAGG + Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1057538013 9:95934723-95934745 GAGGATTAAGTTAAGGATTTGGG + Intronic
1058423008 9:104851188-104851210 CAGAACTAAGTTCATGAGGATGG - Intronic
1058850399 9:109006477-109006499 CAGGATTATGTTAAGGATCAAGG + Intronic
1059575326 9:115481958-115481980 CAGGATTGTGGTAAGGAAGATGG + Intergenic
1060254118 9:122011911-122011933 CAGGGTTAATTTCAGAAGGAAGG + Intronic
1061280117 9:129593139-129593161 CATGATGAAGTTCAGGAGTAGGG + Intergenic
1187075740 X:15932681-15932703 AAGGATATAGTTAAGGAGGCTGG + Intergenic
1188606173 X:32032918-32032940 CAGGATGGAGTAAAGGAGGTAGG + Intronic
1189224501 X:39401451-39401473 CTGGATTCATTTAAGAAGGAGGG + Intergenic
1189672500 X:43425905-43425927 GAGGAATAAGATAAGGGGGAGGG - Intergenic
1190333887 X:49251308-49251330 CAAGATCAAGGAAAGGAGGATGG - Exonic
1190653200 X:52587635-52587657 CAGAATGAACTTAAGGAAGAAGG + Intergenic
1191254250 X:58273001-58273023 CAGGAGTAGGTTCAGGAGGCCGG - Intergenic
1191732943 X:64356930-64356952 CAGGATTAAGTTCTGGAATAAGG + Intronic
1193277024 X:79601724-79601746 CAGGATAAAGTTATGGTTGAAGG - Intergenic
1194014718 X:88605070-88605092 CAGGAGGAAGTTAAGGGGGCAGG + Intergenic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1196685024 X:118503624-118503646 CAGGTTTCAGTTAAGCAAGATGG + Intronic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1196910580 X:120480809-120480831 CAGGGTTCAGTTTAGTAGGAAGG + Intergenic
1197588033 X:128373805-128373827 CTGGAGTAAGCTGAGGAGGAAGG - Intergenic
1198272453 X:135067382-135067404 CTGGATTAGGTTAATCAGGATGG - Intergenic
1199907722 X:152251417-152251439 TAGGTTTAAGTTTTGGAGGAGGG - Intronic
1200584634 Y:4993069-4993091 CAGGATTAAGTTCAGCCTGAAGG + Intergenic
1200968086 Y:9119801-9119823 CAGGATAAGGTTATGGATGAAGG - Intergenic
1201945968 Y:19510220-19510242 CAGGAATAAGTTAATCAGGGTGG - Intergenic
1202142658 Y:21744274-21744296 CAGGATAAGGTTATGGATGAAGG + Intergenic
1202144200 Y:21761344-21761366 CAGGATAAGGTTATGGATGAAGG - Intergenic
1202172632 Y:22067075-22067097 CAGGATTAAGTTTAGGGATATGG - Intergenic
1202218730 Y:22519296-22519318 CAGGATTAAGTTTAGGGATATGG + Intergenic
1202324456 Y:23676759-23676781 CAGGATTAAGTTTAGGGATATGG - Intergenic
1202546315 Y:25993295-25993317 CAGGATTAAGTTTAGGGATATGG + Intergenic