ID: 1090113657

View in Genome Browser
Species Human (GRCh38)
Location 11:123943161-123943183
Sequence GAGAACAGTGGCAAGAATGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090113652_1090113657 4 Left 1090113652 11:123943134-123943156 CCTTCGCTCAGCAGCTGTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1090113657 11:123943161-123943183 GAGAACAGTGGCAAGAATGCAGG 0: 1
1: 1
2: 4
3: 24
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090113657 Original CRISPR GAGAACAGTGGCAAGAATGC AGG Exonic
902943880 1:19819988-19820010 GAGCACAGAGGCGAGAATTCTGG - Intergenic
904262064 1:29293565-29293587 CAGAAGAATGGCATGAATGCGGG - Intronic
904945714 1:34197380-34197402 TAGAGGAGGGGCAAGAATGCAGG - Exonic
905391819 1:37640803-37640825 GAGAACTGTGGCAAGGAAGGGGG - Intergenic
906045353 1:42825895-42825917 GAGACAAGTGACAAGATTGCTGG + Intronic
906213295 1:44024223-44024245 GAGTACAGAGGCCAGACTGCGGG - Intronic
907275469 1:53314468-53314490 GGGGGCTGTGGCAAGAATGCAGG + Intronic
907818117 1:57939850-57939872 CAGAGCAGTGGTAAGAATACAGG - Intronic
908163458 1:61434788-61434810 GAGAACAGTGGCAATAGAGAAGG + Intronic
908231914 1:62113583-62113605 GAGTGCAGTGGCATGAATGCTGG - Intronic
908338831 1:63155341-63155363 GAGAACAGAGGGTAGAATGGAGG + Intergenic
910037708 1:82807955-82807977 GAGAAAAGTGGCAAGGCAGCTGG - Intergenic
910793819 1:91077437-91077459 GAGAACATATGCCAGAATGCAGG - Intergenic
910996227 1:93106959-93106981 GAGAACAGAAGTAAAAATGCAGG - Intronic
912312034 1:108632547-108632569 GAGGACAGTGGTATGAATGATGG + Intronic
912390492 1:109299253-109299275 ATGAACTGTGGCAAGAATCCTGG - Intronic
916797869 1:168184060-168184082 CTGAAGAGTGGCAAGAAAGCAGG + Exonic
917449814 1:175138071-175138093 CTGAGCAGAGGCAAGAATGCTGG + Intronic
917676474 1:177323468-177323490 GAGAAAAGTGGCAGGATTGAGGG - Intergenic
921311826 1:213852038-213852060 GAGAACAGTGGGCAGTATGTGGG - Intergenic
921725419 1:218517910-218517932 CTGAACACTGGCAAGAATGGAGG - Intergenic
921901802 1:220458783-220458805 TAGGACTGTGGCATGAATGCTGG + Intergenic
922200864 1:223400340-223400362 GAGAACTATGTGAAGAATGCAGG - Intergenic
922332682 1:224591243-224591265 GAGAACAGTGGCTGGAATAGAGG - Intronic
1062775428 10:142150-142172 GAGCACAGTGGCGAGAACTCTGG + Intronic
1063269234 10:4487986-4488008 GAGAAAAGTGGCAAGGATTCTGG + Intergenic
1064308503 10:14189834-14189856 GAGAACAATGGCAAAAGTGTTGG + Intronic
1064469484 10:15621348-15621370 GGGGACATTGGCATGAATGCAGG + Intronic
1065572245 10:27083018-27083040 GAGAAGAGTGGCAGGTCTGCAGG - Intronic
1066200734 10:33140883-33140905 GAGAAGAGTGGCGAGAACCCAGG - Intergenic
1067006950 10:42673245-42673267 TAGTACAGTGGCTAGAATGTAGG + Intergenic
1067169258 10:43892736-43892758 GAGAACAGTTACAAGAAAACAGG - Intergenic
1074872828 10:117590488-117590510 CAGGACTGTGTCAAGAATGCAGG - Intergenic
1075775393 10:124981780-124981802 AAGAACAGTGGCAAGAAGACTGG + Exonic
1076201567 10:128563052-128563074 CAGAAAAGTGGCAAGCATGGTGG + Intergenic
1078734345 11:14006414-14006436 AAGAACAGAGGCAGGAAGGCTGG + Intronic
1080349869 11:31370947-31370969 GATACCAGTGGCAGGAATCCAGG + Intronic
1081285545 11:41264929-41264951 CAGAACAGGGCCTAGAATGCAGG + Intronic
1083326256 11:61874443-61874465 GAGAACAGAGGCCAGATTCCAGG - Intronic
1084474330 11:69380369-69380391 GAGAACAGTGGCTGACATGCAGG + Intergenic
1087682984 11:101235762-101235784 GAGAAAAGTGGCAGGATTGAGGG + Intergenic
1088010822 11:104998974-104998996 GAGATGAGTGCCAAGGATGCTGG + Exonic
1088072022 11:105798814-105798836 GAGAACAGAGGAAAGAATATTGG + Intronic
1088944911 11:114501794-114501816 GAGAACATTAGAATGAATGCTGG + Intergenic
1090113657 11:123943161-123943183 GAGAACAGTGGCAAGAATGCAGG + Exonic
1091234415 11:134010941-134010963 GAGAGCAGTGGCATGAATCATGG - Intergenic
1092477911 12:8834837-8834859 GAGGGCAGAGGCAAGAAAGCAGG - Intronic
1094490062 12:30954715-30954737 TAGAAGAGTGACAAGAGTGCAGG + Intronic
1095612855 12:44150901-44150923 AAGAACAGAGGCAAAAATTCTGG + Intronic
1098263657 12:68697023-68697045 GGGAACAGTGGCAGGAGTGGAGG + Intronic
1098841213 12:75480252-75480274 GAGAATAGTAGAAAGAATACAGG - Intergenic
1099143489 12:79009916-79009938 GAGAACAGTGACAGCAATGAGGG - Intronic
1099211742 12:79799452-79799474 GAGCACACTGACAAGAATGCAGG - Intronic
1099447259 12:82767094-82767116 GAGAACAGTGACAGGTATGAAGG - Intronic
1099998028 12:89800600-89800622 TAGCACAGTGGAAAGAGTGCTGG - Intergenic
1100892078 12:99136740-99136762 GGGAACAGGGAGAAGAATGCAGG + Intronic
1102193698 12:111008955-111008977 CGGAAGAGGGGCAAGAATGCTGG - Intergenic
1102223503 12:111211167-111211189 GTGAACTGTGGCAAGAATTCAGG + Intronic
1102441217 12:112965177-112965199 GTGAACAGTGCCAGGGATGCTGG + Intronic
1103898450 12:124290002-124290024 GAGAACAGAGGCAAGAAGAGTGG - Intronic
1104874056 12:132020707-132020729 GAGAATGCTGGCAACAATGCAGG - Intronic
1107090818 13:36477002-36477024 GAGAAGAGAGGCAAGAATTAAGG + Intergenic
1107566481 13:41610546-41610568 GACAATAGAGACAAGAATGCAGG - Intronic
1108585367 13:51865979-51866001 GAGAACAATGGCCACATTGCCGG + Exonic
1110184334 13:72655894-72655916 GAGAACAGAAGGAAGAATGTAGG + Intergenic
1111541387 13:89671642-89671664 GAGAACTGTGTCAAGAATCAAGG - Intergenic
1112095855 13:96130975-96130997 GGGAACAGCGTTAAGAATGCAGG - Intronic
1112442574 13:99434949-99434971 GGGAACTCTGGCAAGCATGCAGG + Intergenic
1113539898 13:111098420-111098442 GAGGACAGGGGCAAGAGTTCTGG - Intergenic
1114156104 14:20104978-20105000 GAGAACGATGTGAAGAATGCAGG + Intergenic
1116342922 14:43749568-43749590 GAGAAAAGTGGGAAGAAGGGAGG - Intergenic
1116778248 14:49206232-49206254 GAGATCACTGGCAAAAATGGAGG + Intergenic
1117194576 14:53326972-53326994 GAGTACAGTGGAAATGATGCTGG + Intergenic
1117839647 14:59846329-59846351 GAGTGCTGTGGAAAGAATGCCGG - Intronic
1117872061 14:60211370-60211392 GAGAACAAAGGTAAGATTGCTGG - Intergenic
1119546810 14:75477889-75477911 GAGAGCAGTGGCGAGGGTGCAGG + Intergenic
1121228398 14:92338808-92338830 GATTGCAGTGGTAAGAATGCAGG + Intronic
1125437600 15:39664094-39664116 GACAGCACTGGCAAGAAAGCAGG + Intronic
1126182736 15:45801730-45801752 GAAAGCAATGGAAAGAATGCTGG - Intergenic
1126315122 15:47361796-47361818 GAGAACAGCAGCCATAATGCTGG - Intronic
1127475249 15:59326955-59326977 GGGAACAGTGGGGAGAATGTAGG + Intronic
1127735943 15:61839554-61839576 GAGAACACTGGAAAGAAGTCAGG - Intergenic
1131519789 15:93105542-93105564 GAGAACATTTGCAAGAATGAGGG + Intergenic
1133313798 16:4869480-4869502 GAGAAAAGCGGCAACACTGCAGG - Intronic
1135341593 16:21653169-21653191 GAATGCAGTGGCAAGATTGCAGG + Intronic
1136538620 16:30915162-30915184 CAGAACAGAGGCAAGGGTGCTGG + Intergenic
1137065792 16:35841777-35841799 GTGAAAAGTGGAAAGAAAGCAGG + Intergenic
1138481776 16:57307962-57307984 GTGAAAAGTGACCAGAATGCAGG - Intergenic
1141838507 16:86559103-86559125 GAGAACAGCACCTAGAATGCAGG + Intergenic
1141873637 16:86806626-86806648 GAGCAGCTTGGCAAGAATGCAGG + Intergenic
1142788190 17:2241987-2242009 GTGCACAGTGGGAAGAAGGCAGG + Intronic
1142908044 17:3061651-3061673 GACTACAGTGGGAAGAATGGTGG - Intergenic
1142926521 17:3242615-3242637 GACTACAGTGGGAAGAATGGTGG + Intergenic
1143961256 17:10722614-10722636 GACAACAGTGGCATAAAAGCTGG - Intronic
1144142149 17:12360035-12360057 AGGAACAGTTGCAAGAAAGCAGG + Intergenic
1146516352 17:33492777-33492799 GAGAACAGAGGCAAAGAGGCTGG - Intronic
1151820318 17:76493473-76493495 CAGGAAAGTGGCAAGAAGGCTGG + Intronic
1153231491 18:2941140-2941162 GAGAGCAGTGGAAAGAATAAGGG - Intronic
1153379888 18:4426514-4426536 GAGAATAGTGTTAAGAATGGTGG + Intronic
1153664456 18:7356296-7356318 AACAACAGAGGCCAGAATGCTGG - Intergenic
1158119649 18:54034423-54034445 GAGGACACTGACAAGAGTGCTGG - Intergenic
1158498566 18:57979270-57979292 GAGAACAGTGGCAATTCTGGGGG - Intergenic
1159662091 18:71110267-71110289 GGGAACAGTGGCAGGACTGACGG - Intergenic
1160323458 18:77917955-77917977 AAGAACAGTGCCCAGACTGCTGG - Intergenic
1160390725 18:78529720-78529742 GAGAACAGTGGCTATACAGCTGG + Intergenic
1161597861 19:5161026-5161048 GAGAAAAGTGGCAGGATTGAGGG + Intronic
1161932292 19:7349042-7349064 GAGCAGAGTGGCAAGCATGCAGG + Exonic
1162718166 19:12646919-12646941 GAGGACAGTGGCCAGATTGAGGG - Intronic
1162969910 19:14174347-14174369 GGGAAGAGAGGCAAGATTGCTGG + Intronic
1165157572 19:33797315-33797337 CAGAACAGGGGCCAGAGTGCGGG - Intronic
1165739714 19:38197981-38198003 GAGAACAGAGGCAACACGGCCGG - Intronic
1166985632 19:46658919-46658941 GAGAAGAGAGGCAGGAATCCTGG - Intronic
1167553110 19:50174673-50174695 GAGAAAAATAACAAGAATGCAGG + Intergenic
925218287 2:2116361-2116383 GAGAAGAGAGGCAAGAATGCAGG - Intronic
925516522 2:4689642-4689664 GAGAGCAGGGGCAAGGATGGAGG + Intergenic
926048184 2:9725519-9725541 GAGTACAGTGGCATGAGTGAAGG - Intergenic
926180127 2:10635335-10635357 GAGAACAGTAGAGAGAATGTTGG - Intronic
928059884 2:28101059-28101081 GATAACAGTGCCAATAATGGTGG + Intronic
928969972 2:37017633-37017655 GAGTACAGTGGCATGAATCTTGG - Intronic
929973079 2:46601296-46601318 GAGCACAGTGTCATGAAGGCTGG - Intronic
932727242 2:74189915-74189937 GAACACATTGGCCAGAATGCAGG - Intergenic
935743030 2:106167640-106167662 AATAAAAGTGGCAAGAAAGCAGG + Intronic
937191451 2:120104166-120104188 GAGCACAATGTGAAGAATGCAGG + Intronic
937866538 2:126755845-126755867 GAGAAATGTGGAAAGAATGATGG - Intergenic
938115748 2:128602064-128602086 GAGATCAGTGGGCAGAAAGCCGG + Intergenic
938664894 2:133524612-133524634 GAGAGCAGTGGGAAGAAAGGAGG - Intronic
938771614 2:134505695-134505717 GGGAACAGTGGTGATAATGCCGG + Intronic
940862228 2:158782778-158782800 GAGAAGAGTGGAATGATTGCAGG + Intergenic
941002973 2:160220901-160220923 GAGAACAAAGGCAAGGAAGCTGG - Intronic
941720013 2:168802586-168802608 GATTACAGTGTCCAGAATGCTGG + Exonic
943332908 2:186581403-186581425 TGGAACACTGGCAAGAATCCTGG + Intergenic
944223752 2:197328473-197328495 CAGAACAGTGGCAAGACAACGGG - Intergenic
945039873 2:205734661-205734683 GAGAAAAGTGGCAGGAATGCAGG - Intronic
945548396 2:211187413-211187435 AAGAACAGAGGCTAGAATCCTGG - Intergenic
946402851 2:219477581-219477603 GAGAAGAGGTGCAAGAATGTTGG - Intronic
946439938 2:219686612-219686634 AACAACAGTGGAAGGAATGCAGG - Intergenic
946720299 2:222598695-222598717 GACAACACTGGCAAGGATACTGG + Intronic
946799087 2:223390684-223390706 GAGAACAGGAGCAAGAAAGTGGG + Intergenic
947060543 2:226159960-226159982 GAGAGGAATGTCAAGAATGCAGG + Intergenic
1169704089 20:8483012-8483034 GAGAACAATGTCAAGATTTCAGG - Intronic
1170362718 20:15564696-15564718 CAGAAAAGTTGCAAGAATGCTGG + Intronic
1171786535 20:29470960-29470982 GAGAACTATGTGAAGAATGCAGG - Intergenic
1172292790 20:33788369-33788391 GAGTGCAGTGGCAAGATTTCAGG - Intronic
1172936403 20:38623522-38623544 GAGGACAGTGGCGGGAATGAAGG + Exonic
1173269645 20:41521035-41521057 GAGAACAGTAGCAGGGATACAGG + Intronic
1174421097 20:50399647-50399669 GACAAGAGTGACAAGAAGGCAGG + Intergenic
1175448999 20:59046450-59046472 GAGCTCTGTGACAAGAATGCGGG - Intergenic
1175968809 20:62673613-62673635 GAGAAGAGTGGCGAGAAGGTGGG - Intronic
1176225370 20:63995136-63995158 TAGATCAGTGGCAGGAATGGTGG + Intronic
1178375891 21:32067319-32067341 AAGAACAGAGGCAAGTAGGCAGG - Intergenic
1178467830 21:32864748-32864770 GAGAACAGTGGAAGGAAGGAAGG - Intergenic
1179200007 21:39208402-39208424 GAGACCAGAGGCAGTAATGCAGG + Intronic
1179681656 21:43025894-43025916 TAAAAGAATGGCAAGAATGCAGG - Intronic
1181305702 22:21916238-21916260 GGAAACAGAGGCAAGAATCCTGG - Intergenic
1182341558 22:29625809-29625831 GAGAACAGTGGCAAAAGAGTTGG - Intronic
1183452457 22:37904600-37904622 GATAACAGTGGCAGGAAAGCAGG - Intergenic
1184334898 22:43847428-43847450 GAGACCAGTGGGAGGAGTGCTGG - Intronic
1184987251 22:48144346-48144368 GAGAACATTGGCGAGACTCCTGG + Intergenic
949421853 3:3874057-3874079 TTGAACAGTGGCAAGAAGACCGG - Intronic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
951078023 3:18420808-18420830 GAGTACAGGTGCAAAAATGCAGG - Exonic
952165983 3:30749374-30749396 AAGAAGACTGGCCAGAATGCTGG + Intronic
952561519 3:34599358-34599380 GAGGAAAGTGTCATGAATGCTGG - Intergenic
953119348 3:40024665-40024687 GAGAACAGCTGCGAGAAAGCTGG - Intronic
953183211 3:40615591-40615613 GAGATCAGTGCCGAGAATCCCGG - Intergenic
954690344 3:52392337-52392359 GCCAACACTGGCAAGGATGCTGG + Intronic
954903166 3:54037469-54037491 GACAGCAGTGGCAATAATGATGG + Intergenic
956094745 3:65704071-65704093 GAGAAGAGGGGAAAGAAGGCAGG + Intronic
956237051 3:67083935-67083957 GAGGACAGTGGCAAAAATTAGGG + Intergenic
956713941 3:72061956-72061978 CATAAAAGTGGTAAGAATGCGGG + Intergenic
958548878 3:95590569-95590591 GAGAAAAGTGGCAAGGTTGAGGG + Intergenic
960278899 3:115758865-115758887 GAGAACAGTAGCAATTATGCAGG + Intergenic
963779904 3:149476506-149476528 GAGTGCAGTGGAAAGAATGCTGG + Intronic
963986407 3:151599470-151599492 GATAACAGAGGCAAGAAGGTGGG + Intergenic
964618948 3:158701245-158701267 GAGGACAGTGCCAAGAACACGGG - Intronic
964786415 3:160400647-160400669 GACACGAGTGGCAAGAAGGCAGG - Intronic
966668916 3:182505498-182505520 GGGACCAATGGCAAAAATGCAGG - Intergenic
967281903 3:187831268-187831290 TAGCAGAGGGGCAAGAATGCAGG - Intergenic
967725472 3:192858343-192858365 GAGAACAGTGGAAATGGTGCTGG - Intronic
967866878 3:194197581-194197603 GAGACTAGTGGTAGGAATGCTGG - Intergenic
969656162 4:8499711-8499733 GAGAACAGTGGGCAGAAAGAGGG + Intergenic
970074358 4:12200734-12200756 GAGAAGAGAGGCAATATTGCTGG - Intergenic
970592680 4:17573068-17573090 TTGAACAGTTGCAAGAATACAGG + Intergenic
973194992 4:47429295-47429317 GAAAACAGAGGCAATAATCCTGG - Intergenic
973547985 4:52001363-52001385 GAAAACAGAGGCAGGAGTGCAGG + Intronic
974526896 4:63057748-63057770 GAGAAGAGTGGCAGGATTGAGGG - Intergenic
977173040 4:93786208-93786230 GAGAACAGTGTTCAGAATGGTGG + Intergenic
978340669 4:107719020-107719042 TAGAACAGTGGAAAGAGCGCTGG - Intronic
978961770 4:114688208-114688230 GGGAACAGTGGCAATAAGCCAGG - Intergenic
979104173 4:116663788-116663810 TTGAATAGTGGCAAGAATGTGGG - Intergenic
979108813 4:116723840-116723862 GAGCAGAGTGGCAAGTTTGCTGG + Intergenic
979194200 4:117900461-117900483 AAGCCCAGTGGCAAGAAGGCTGG - Intergenic
979819510 4:125152889-125152911 CAAAACACTGGCAAGAATGGAGG - Intergenic
981142454 4:141284733-141284755 CAGAACATTGGAAAGAATACTGG + Intergenic
982067012 4:151663197-151663219 TAGAACAGAGGCCAAAATGCAGG - Exonic
983848371 4:172547188-172547210 GTGAGCAGTGGTTAGAATGCAGG + Intronic
983955215 4:173689600-173689622 GAGATCAGTAGCTAGAATGCAGG + Intergenic
984970960 4:185189726-185189748 AGGGACAGTGGCAAGAATGCTGG - Intronic
987060602 5:14239686-14239708 GACAATAGTGGAAAGAATGTGGG - Intronic
988180187 5:27781513-27781535 TAAAAAAGTGGCAAGAAAGCAGG - Intergenic
988358126 5:30202513-30202535 GAGAACAGTGGCAGGGTTGAGGG - Intergenic
988504127 5:31807263-31807285 GAGCACAGTGCAAAGAATGCGGG + Intronic
991124788 5:63057463-63057485 GGCAATAGTGGCAATAATGCCGG - Intergenic
991493948 5:67209867-67209889 GAGAACTATGGCAAGAATGCCGG - Intergenic
991630972 5:68656017-68656039 GAGAACTTTGTCAAGAATCCTGG - Intergenic
993115178 5:83711487-83711509 GAGAACGCTGGCAAGCATGATGG + Intronic
996207038 5:120752326-120752348 GATAACAGTGGAGATAATGCGGG + Intergenic
996975763 5:129432483-129432505 TAGAAGTGTGGCAAAAATGCTGG - Intergenic
997179639 5:131814813-131814835 GGCCACAGTGGCAAGAATGGAGG + Intronic
1000377686 5:160598644-160598666 TGGAACAGTGGTCAGAATGCAGG + Intronic
1001446423 5:171787476-171787498 GAAACCAGCAGCAAGAATGCCGG + Intronic
1001692566 5:173643941-173643963 GAGAGCTGTGGCCAGGATGCAGG - Intergenic
1002000489 5:176194039-176194061 GACCAGAGTGGCAAAAATGCAGG + Intergenic
1002170135 5:177370369-177370391 GAGAAAAGTGGCAAGAATGCTGG - Intronic
1002253847 5:177944942-177944964 GACCAGAGTGGCAAAAATGCAGG - Intergenic
1002783919 6:386902-386924 GAGAACAATGGCCAGGAGGCCGG - Intergenic
1003150377 6:3542948-3542970 GAGCACAGTGGATGGAATGCTGG + Intergenic
1003425894 6:5997948-5997970 GAGAACTGGGTCAAGAAAGCAGG + Intergenic
1006691435 6:35890314-35890336 GCCAACAGTGGCAAGAATCAAGG + Intronic
1007619504 6:43203465-43203487 CGGAACAGTGGCCAGAATGTGGG - Exonic
1007949150 6:45854682-45854704 GAGAACAGTAGCCAGTGTGCTGG + Intergenic
1010154883 6:72780934-72780956 GAAAACAGTGGAAAGAACACTGG - Intronic
1011321556 6:86099462-86099484 GAAAACAGTAGCAGGATTGCTGG + Intergenic
1011666643 6:89641114-89641136 GGAAACACTGGCAGGAATGCTGG + Intergenic
1012444897 6:99297394-99297416 GAGAAGAATGGCCAGAATCCAGG + Intronic
1013164395 6:107576664-107576686 GGAATCAGTGGCAAGAGTGCAGG + Intronic
1013186114 6:107759887-107759909 CAGGGCAGTGGCAAGAATACAGG + Intronic
1013227482 6:108130593-108130615 GAGAAAACTGGCCAGAATGAAGG - Intronic
1013928285 6:115499586-115499608 GAGAACAGTTACAGAAATGCTGG - Intergenic
1014293588 6:119590169-119590191 GAGAACAGAGGAAAAAAAGCAGG + Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1015861597 6:137686811-137686833 CAGAACAGTGGCTGCAATGCTGG - Intergenic
1015882004 6:137879170-137879192 CAGCTCTGTGGCAAGAATGCGGG - Exonic
1017856727 6:158356347-158356369 GAGGACAGTGACATGAATCCAGG + Intronic
1018894828 6:168006580-168006602 GAGAACAGTTAAAAAAATGCTGG + Intronic
1019933817 7:4241527-4241549 TAAAACACTGGCAAGAATACTGG + Intronic
1021899380 7:25268441-25268463 GAGACAAAGGGCAAGAATGCTGG + Intergenic
1023051022 7:36251250-36251272 TAGGACAGTGGCAAAAATGACGG - Intronic
1026888676 7:73969513-73969535 GAGTTCAAGGGCAAGAATGCTGG + Intergenic
1028269718 7:88773785-88773807 CAGAACAGGGGCAAGAAAGGGGG + Intronic
1030580323 7:111347124-111347146 GAGAACAGAGGCAGAAAGGCTGG + Intronic
1031330108 7:120453438-120453460 GAGAACATGTGCAGGAATGCTGG + Intronic
1033902837 7:146163694-146163716 GAGTGCAGTGGCAAGATTTCAGG - Intronic
1034217873 7:149421985-149422007 GAGAAAAGTGGGTAGAATGCAGG + Intergenic
1035830417 8:2688868-2688890 GAGAGCAGCGGCTAGAGTGCCGG - Intergenic
1036111218 8:5905051-5905073 GAGAACAGAGGCAAGTCTGCCGG + Intergenic
1036650418 8:10638821-10638843 GAGAGCAGAGGCAAGAACGTGGG - Intronic
1036688914 8:10928981-10929003 GAGCACAGTCTCAAGAAAGCTGG + Intronic
1037091871 8:14929716-14929738 GACAGCAGTGGTATGAATGCAGG + Intronic
1039189925 8:34962207-34962229 TAAAACAGAGTCAAGAATGCAGG + Intergenic
1039976183 8:42367140-42367162 GAGAACAGTGCCTGGAATGGAGG - Intronic
1040289047 8:46115041-46115063 GAAAGAAGTGGCAAGATTGCAGG - Intergenic
1040289858 8:46118715-46118737 GAGAGAAGCGGCAAGATTGCAGG - Intergenic
1040290559 8:46121966-46121988 GGGAAAAGCGGCGAGAATGCAGG - Intergenic
1040295933 8:46149090-46149112 GAGAGAAGCGGCAAGACTGCAGG - Intergenic
1040306941 8:46216951-46216973 GGGAGAAGTGGCAAGACTGCAGG + Intergenic
1040315351 8:46258001-46258023 GAGAAAAGCGGCGAGACTGCAGG + Intergenic
1040316389 8:46263141-46263163 GAGAGAAGTGGCAAGACCGCAGG + Intergenic
1040334632 8:46409809-46409831 GGGATAAGTGGCAAGACTGCAGG + Intergenic
1040966260 8:53083835-53083857 GAGAACAGTGGTAGAAATACTGG - Intergenic
1040971146 8:53138685-53138707 GAGAAAAGTGGCAGGGATGAGGG + Intergenic
1041636001 8:60145460-60145482 ATGCACAGTGGCAAGAAGGCAGG + Intergenic
1041893142 8:62894131-62894153 GATTTCAGTGGCAAAAATGCTGG + Intronic
1042556683 8:70039284-70039306 GAGAACAGTGACAAGAGTGCAGG + Intergenic
1043468499 8:80538141-80538163 GAGTACAGTGGCATGAATCTCGG - Intergenic
1043850195 8:85207354-85207376 GAATACAGTGGCAAGAATGTGGG - Intronic
1044147581 8:88736396-88736418 GACAACAGTGTCAGGCATGCAGG + Intergenic
1044688935 8:94857439-94857461 GAGAACATTGGGAAAAATGAAGG + Intronic
1048326455 8:133442942-133442964 GAGGACAGTGGAAAGGAGGCTGG - Intergenic
1049455534 8:142684494-142684516 GAGAAGAAGGGCAAGGATGCGGG + Intergenic
1054777179 9:69133481-69133503 GAGCAGTGTGGCAGGAATGCAGG - Intronic
1056318450 9:85414423-85414445 GAGCTCAGTGACAATAATGCTGG + Intergenic
1057422164 9:94921282-94921304 GAGCACAGTTCCAAGAATGCAGG + Intronic
1057818102 9:98310569-98310591 GAGTAAAGTGGAAAGAGTGCTGG + Intronic
1058039473 9:100288219-100288241 GAGAGCAGAGCCAAGAATTCAGG - Intronic
1058351593 9:104031279-104031301 GAATACAATGGCTAGAATGCTGG - Intergenic
1058607940 9:106743612-106743634 GAGAACATTGGCAGAAGTGCTGG + Intergenic
1059664226 9:116430843-116430865 GAGACCAAAGGCAAAAATGCTGG + Intronic
1060651091 9:125327897-125327919 GAGAACAGATGAAAGAAAGCTGG - Intronic
1061201953 9:129143155-129143177 GAGAACAGTGCCAAGAGGGCAGG - Intronic
1186899707 X:14040759-14040781 GGGAACAATGGCAAGAAAGATGG + Intergenic
1187665496 X:21604715-21604737 GGAAATAGTGGGAAGAATGCTGG + Intronic
1187853782 X:23617122-23617144 GAGTGCAGTGGCAAGAATATGGG - Intergenic
1188416244 X:29938506-29938528 GAGAAGTGTGGGAAGAAAGCTGG - Intronic
1192285351 X:69729227-69729249 GAGAAAAGTGGCACAGATGCTGG - Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194585767 X:95732327-95732349 GAAAAGATTGGCAACAATGCAGG + Intergenic
1194738430 X:97542928-97542950 GACAAGAGTAGAAAGAATGCGGG + Intronic
1195134869 X:101894985-101895007 GCTAAGAGTGGCAAGAATTCAGG - Intronic
1195162422 X:102183618-102183640 CAGAAAAGTGGCAAGAATGTGGG + Intergenic
1195166459 X:102225215-102225237 CAGAAAAGTGGCAAGAATGTGGG + Intronic
1195192401 X:102461873-102461895 CAGAAAAGTGGCAAGAATGTGGG - Intronic
1195383900 X:104295837-104295859 GGGAATCTTGGCAAGAATGCTGG + Intergenic
1196941361 X:120779440-120779462 GAGTACAGTGGCACGATTTCAGG + Intergenic
1198722848 X:139642655-139642677 TAGCACAGTGGCAGCAATGCTGG + Intronic
1199895512 X:152123256-152123278 CAAAACAGTGGCAAGAAAACAGG - Intergenic
1200042421 X:153379783-153379805 GAGAGCCCAGGCAAGAATGCAGG + Intergenic
1200959596 Y:8984768-8984790 GAGAAAAGTGACAGGAATGAGGG - Intergenic
1201556058 Y:15265612-15265634 GAGAAAAGTGGCAGGGATGAGGG - Intergenic
1201639953 Y:16167969-16167991 GAGAAAAGTGGCAGGATTGAGGG + Intergenic
1201662860 Y:16417356-16417378 GAGAAAAGTGGCAGGATTGAGGG - Intergenic