ID: 1090117919

View in Genome Browser
Species Human (GRCh38)
Location 11:123994499-123994521
Sequence AAAGGTGACCAGCTCGTTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090117916_1090117919 -4 Left 1090117916 11:123994480-123994502 CCAGGAAGCCAATGTCTGCAAAG 0: 1
1: 0
2: 0
3: 21
4: 205
Right 1090117919 11:123994499-123994521 AAAGGTGACCAGCTCGTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090117919 Original CRISPR AAAGGTGACCAGCTCGTTGA TGG Exonic
902976868 1:20094916-20094938 AAGGGTGACCAAGTAGTTGATGG + Intergenic
903523116 1:23970155-23970177 AAATTTGAGCAGGTCGTTGATGG - Intronic
905316570 1:37085335-37085357 AAAGGAGACAAGGTGGTTGAGGG - Intergenic
908117209 1:60952062-60952084 AAAGGTGACTAACTCAATGAAGG - Intronic
909171482 1:72301520-72301542 TCAGGTCACCACCTCGTTGATGG - Intergenic
913156930 1:116108797-116108819 AAAGAAGACCAGCTTTTTGATGG + Intergenic
919506169 1:198400055-198400077 AAAGGAGACTAGCTTTTTGAGGG + Intergenic
919660660 1:200241999-200242021 AAAGGTGTCCAGCTTATTTATGG - Intergenic
920799369 1:209173100-209173122 GAAGTCGACCAGCTCGTTGAGGG - Intergenic
1070544843 10:77444207-77444229 AAAGGTGACAAGCACATTGCAGG + Intronic
1072031979 10:91529963-91529985 AAAGGTGACCAGATCTTTATGGG - Intergenic
1074210696 10:111331519-111331541 ACAGGGGAACAGCTCGTTGATGG - Intergenic
1080860816 11:36148798-36148820 ACAGATGACCAGCTCTGTGAAGG + Intronic
1087505001 11:99009548-99009570 AAAGGTGACAAGATGGATGATGG + Intergenic
1090117919 11:123994499-123994521 AAAGGTGACCAGCTCGTTGATGG + Exonic
1090424712 11:126599432-126599454 AAAGGTGACCAGCTCTTCCTGGG + Intronic
1090531925 11:127600091-127600113 CAGTGTGACCAGCTTGTTGAAGG + Intergenic
1092519005 12:9247167-9247189 AAAGGTGAGCACCTTGTTGGAGG - Intergenic
1094296206 12:28908463-28908485 AAAGAAGACCAGTTAGTTGAAGG - Intergenic
1098340717 12:69448178-69448200 AAAGGTGACCACCCCATTGGTGG + Intergenic
1101159220 12:101956286-101956308 AGAGGTGACCATCTAGTTGTAGG - Intronic
1104555362 12:129795176-129795198 AATGATGACCAGCTCCTGGAAGG - Intronic
1109166435 13:59040663-59040685 GAAGGTGATCTGCTGGTTGATGG - Intergenic
1121079311 14:91095012-91095034 AGAGGTGACCAGCTGCTGGAGGG - Intronic
1124946287 15:34270113-34270135 AATGGTGACCAGTTAGTTGTGGG + Intronic
1129178771 15:73858546-73858568 CAAGGTGACCAGCCTTTTGAAGG + Intergenic
1130771453 15:86927886-86927908 AAAGGTGAGCAGCTACTTCAAGG + Intronic
1136987173 16:35118294-35118316 AAAGGGGACCATCTTGTTGCTGG - Intergenic
1137321948 16:47393070-47393092 AAATTTGACCAGCTAGTAGAGGG + Intronic
1138256797 16:55571571-55571593 AAAGGAGACCAGCTCTTTGGAGG - Intronic
1138339610 16:56280139-56280161 GAAGATGACCAGCTCCTTAAAGG - Intronic
1138538359 16:57672713-57672735 AAAGGTTACTAGCTAGTTGGAGG - Intronic
1140070983 16:71649392-71649414 GATGATGACCAGCCCGTTGAGGG - Exonic
1144957108 17:19024281-19024303 GAAGTCGACCAGCTCGTTGAGGG + Exonic
1146712158 17:35051426-35051448 AAAGGTTACCTACTTGTTGAAGG - Intronic
1147558109 17:41492402-41492424 GCAGGTGACCAGCTCGTCAAAGG + Intronic
1149470813 17:56913911-56913933 AGTGGTGACCGGCTCCTTGAAGG + Exonic
1164854807 19:31512579-31512601 AAAGGTGTCCAGCTCCTTCGTGG + Intergenic
927972054 2:27312048-27312070 AAAGGTGAACAGTTGGGTGATGG + Intronic
937436565 2:121886520-121886542 AAAGGTGAACAGCCAGGTGAAGG + Intergenic
938078816 2:128358226-128358248 AAGGGTGCCCAGCTGGTTGATGG - Intergenic
939581203 2:143948130-143948152 TAAGGTGACCAGTTTCTTGAAGG + Intronic
940040482 2:149354668-149354690 AAAGGTGAGCAGGTGGTTGATGG - Intronic
940547710 2:155110162-155110184 AAAGGTGACTGGGTCATTGAAGG + Intergenic
942616199 2:177794311-177794333 AAATGTGCCCAGCTTGTTTAAGG + Intronic
946845916 2:223858984-223859006 AAAGGAGACCAGCCAGGTGAAGG + Intronic
948092740 2:235308417-235308439 AGAGTTCCCCAGCTCGTTGAAGG + Intergenic
1168989501 20:2082161-2082183 AAAGATGACCAGCTTTGTGATGG + Intergenic
1174778297 20:53365568-53365590 AGAGGTGACCAGCTAGATGCTGG + Intronic
1179503562 21:41824864-41824886 AAAGGTCAAAAGCTCGGTGATGG + Intronic
1181939273 22:26462968-26462990 CAAGGTGACTAGCTCATTTATGG + Intronic
951701717 3:25503562-25503584 TAAGGTGATAAGCTCCTTGAGGG - Intronic
956667588 3:71656648-71656670 AAAGGTTACCAGCTTGTCCAGGG + Intergenic
963944463 3:151130338-151130360 AAAGATGACAAGATTGTTGACGG - Intronic
964335714 3:155652218-155652240 AAATGTGAACAGCTGTTTGAGGG - Intronic
965085803 3:164095974-164095996 AAAGGTCACCTTCTCGATGAAGG - Intergenic
969548005 4:7844585-7844607 AAAGGAGACCATCTCGTTGGCGG + Intronic
996135280 5:119833960-119833982 AAAGGGGACCAACTTGATGAAGG - Intergenic
999863436 5:155674367-155674389 AAAGGAGACCAGAGCTTTGAAGG - Intergenic
1004583056 6:16973057-16973079 AAAGGAGCCCAGTTCTTTGATGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1010051607 6:71511074-71511096 ATAGTTGACCAGCTGGTTAATGG - Intergenic
1011982123 6:93392317-93392339 AAAGGTAACCATCCCTTTGAGGG - Intronic
1021470572 7:20997934-20997956 AAAGAGGACCAGCTGGTTGATGG - Intergenic
1022162758 7:27728228-27728250 AAAGGTGAGTAGTTCTTTGAAGG - Intergenic
1022539653 7:31123905-31123927 AAGAGTGCCCAGCTCATTGAAGG - Intergenic
1031922872 7:127614274-127614296 CAAGGTCACCACCTAGTTGATGG - Intronic
1035903267 8:3480484-3480506 AAAGGAGACGAGCTAGATGATGG + Intronic
1036527670 8:9550295-9550317 AAAGGAGACCTGCTTGTTGTTGG + Intergenic
1041437149 8:57854850-57854872 ATAGGCGACCAGCTCCTTCAGGG + Intergenic
1043954479 8:86344373-86344395 AAAGATTACCATCTCTTTGAAGG - Intronic
1051103475 9:13549891-13549913 AAAGTTGACCAATTCCTTGAAGG - Intergenic
1055398765 9:75900858-75900880 AAAGCTCACCAGCTAGTGGAAGG - Intronic
1060316873 9:122519718-122519740 GAAAATGACCAGCTCATTGAGGG - Exonic
1188634530 X:32412650-32412672 AAAAGTGAACAGATCCTTGAAGG - Intronic
1189143001 X:38626350-38626372 AAAGATTAACAGCTGGTTGATGG - Intronic
1189703792 X:43739240-43739262 TAATGTGAGCAGCTCTTTGAAGG + Intronic
1192272823 X:69599500-69599522 AGAGGTGACTAGGTCATTGAGGG - Intergenic
1198786799 X:140297597-140297619 TAAGGTCACCAGTTAGTTGAAGG + Intergenic
1199594796 X:149498088-149498110 CAAGGTGAAGAGCTGGTTGAGGG - Exonic