ID: 1090128418

View in Genome Browser
Species Human (GRCh38)
Location 11:124114913-124114935
Sequence GATCCTGAAACCAAATGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090128418_1090128423 7 Left 1090128418 11:124114913-124114935 CCCAAACATTTGGTTTCAGGATC No data
Right 1090128423 11:124114943-124114965 CGACCCATGACAGGAAGACTTGG No data
1090128418_1090128424 8 Left 1090128418 11:124114913-124114935 CCCAAACATTTGGTTTCAGGATC No data
Right 1090128424 11:124114944-124114966 GACCCATGACAGGAAGACTTGGG No data
1090128418_1090128427 17 Left 1090128418 11:124114913-124114935 CCCAAACATTTGGTTTCAGGATC No data
Right 1090128427 11:124114953-124114975 CAGGAAGACTTGGGCTTCCCTGG No data
1090128418_1090128420 -2 Left 1090128418 11:124114913-124114935 CCCAAACATTTGGTTTCAGGATC No data
Right 1090128420 11:124114934-124114956 TCCCATAAGCGACCCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090128418 Original CRISPR GATCCTGAAACCAAATGTTT GGG (reversed) Intergenic