ID: 1090128419

View in Genome Browser
Species Human (GRCh38)
Location 11:124114914-124114936
Sequence GGATCCTGAAACCAAATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090128419_1090128424 7 Left 1090128419 11:124114914-124114936 CCAAACATTTGGTTTCAGGATCC No data
Right 1090128424 11:124114944-124114966 GACCCATGACAGGAAGACTTGGG No data
1090128419_1090128420 -3 Left 1090128419 11:124114914-124114936 CCAAACATTTGGTTTCAGGATCC No data
Right 1090128420 11:124114934-124114956 TCCCATAAGCGACCCATGACAGG No data
1090128419_1090128423 6 Left 1090128419 11:124114914-124114936 CCAAACATTTGGTTTCAGGATCC No data
Right 1090128423 11:124114943-124114965 CGACCCATGACAGGAAGACTTGG No data
1090128419_1090128427 16 Left 1090128419 11:124114914-124114936 CCAAACATTTGGTTTCAGGATCC No data
Right 1090128427 11:124114953-124114975 CAGGAAGACTTGGGCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090128419 Original CRISPR GGATCCTGAAACCAAATGTT TGG (reversed) Intergenic