ID: 1090128423

View in Genome Browser
Species Human (GRCh38)
Location 11:124114943-124114965
Sequence CGACCCATGACAGGAAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090128418_1090128423 7 Left 1090128418 11:124114913-124114935 CCCAAACATTTGGTTTCAGGATC No data
Right 1090128423 11:124114943-124114965 CGACCCATGACAGGAAGACTTGG No data
1090128419_1090128423 6 Left 1090128419 11:124114914-124114936 CCAAACATTTGGTTTCAGGATCC No data
Right 1090128423 11:124114943-124114965 CGACCCATGACAGGAAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090128423 Original CRISPR CGACCCATGACAGGAAGACT TGG Intergenic