ID: 1090130324

View in Genome Browser
Species Human (GRCh38)
Location 11:124135270-124135292
Sequence CAAGATGCTGACAGGGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090130320_1090130324 -1 Left 1090130320 11:124135248-124135270 CCAGTAGCTGCAAGCTCAGAGAC 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1090130324 11:124135270-124135292 CAAGATGCTGACAGGGATCTGGG 0: 1
1: 0
2: 2
3: 28
4: 252
1090130319_1090130324 0 Left 1090130319 11:124135247-124135269 CCCAGTAGCTGCAAGCTCAGAGA 0: 1
1: 0
2: 1
3: 21
4: 262
Right 1090130324 11:124135270-124135292 CAAGATGCTGACAGGGATCTGGG 0: 1
1: 0
2: 2
3: 28
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090130324 Original CRISPR CAAGATGCTGACAGGGATCT GGG Intronic
900115701 1:1026948-1026970 CAAGATTGTGGCTGGGATCTAGG + Intronic
900395995 1:2453484-2453506 CGGAATGCTGACAGTGATCTGGG + Intronic
903666632 1:25011961-25011983 GAAGATGCTGACGGGGAGCTCGG - Intergenic
904413641 1:30341610-30341632 CTAGATGCTGGCTGGGATCCAGG - Intergenic
906051830 1:42880811-42880833 CAGGAGGCTGACAGGATTCTGGG - Intergenic
909712517 1:78668102-78668124 CAACATGCTAAGAGGGATTTGGG + Intergenic
912013770 1:105005694-105005716 CAGGAGGCAGACAGGGTTCTGGG - Intergenic
916358067 1:163935614-163935636 CAAGATGAGCTCAGGGATCTGGG + Intergenic
919921647 1:202169708-202169730 CAGGATGCTGGCAGGGACCCTGG - Intergenic
923017224 1:230136306-230136328 ACATGTGCTGACAGGGATCTGGG - Intronic
923187319 1:231586768-231586790 CAAGATGCTGACAGGTTCATGGG + Intronic
924075813 1:240335473-240335495 CAACCTGATGACAGGCATCTTGG + Intronic
1066983885 10:42446640-42446662 CGAGATGCTTACAGGGATTCTGG - Intergenic
1069827449 10:71262802-71262824 CAACAGTCTGACAGGGTTCTGGG - Intronic
1069894336 10:71671321-71671343 CCAGATGGTGACAGGGATTGGGG - Intronic
1072633500 10:97163294-97163316 CAAGCTGCTGCCAGGGATGAGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073458570 10:103652447-103652469 AAAGATGCTGAGAGGGATGAGGG + Intronic
1076451055 10:130557330-130557352 ACATATGCTGCCAGGGATCTGGG - Intergenic
1076457248 10:130608978-130609000 GAGGATGCTGTCAGGGATGTGGG - Intergenic
1076457254 10:130609018-130609040 GAGGATGCTGTCAGGGATGTGGG - Intergenic
1077132639 11:980951-980973 TTCGATGCTGGCAGGGATCTGGG + Intronic
1077301648 11:1850036-1850058 CAGGATGCTCACGGGGCTCTGGG - Intergenic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079137211 11:17782426-17782448 CTAGCTGCTGTCAGGGGTCTTGG - Exonic
1079300979 11:19278672-19278694 AAAGATCAAGACAGGGATCTGGG + Intergenic
1080198272 11:29637286-29637308 TAAGAGGTAGACAGGGATCTGGG - Intergenic
1081420289 11:42867713-42867735 CAAGATGCTGACTCTTATCTTGG - Intergenic
1081462101 11:43281407-43281429 CAGGAAGATGGCAGGGATCTTGG - Intergenic
1081709471 11:45207722-45207744 CAAGATGGTGGCAGGAATATGGG - Intronic
1081710528 11:45212857-45212879 CCAGACGCTGACAGAGATCCGGG + Intronic
1085526570 11:77167474-77167496 CAGCATTCTGACAGGGAGCTGGG + Intronic
1085741756 11:79083213-79083235 CAAGATGGGGACAGGGATCCAGG + Intronic
1086094662 11:83038316-83038338 CAAGATGCTGAAAGGCTTTTTGG + Intronic
1087407898 11:97752507-97752529 CAAGAGGCAGACAGGCTTCTAGG - Intergenic
1087591958 11:100200858-100200880 AAAAATGCTTACAGGTATCTAGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1090130324 11:124135270-124135292 CAAGATGCTGACAGGGATCTGGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096331698 12:50718765-50718787 CAAGCTGCTGGAAGGGATCTGGG + Exonic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101759884 12:107649830-107649852 CAAGAGGCAGACAGGGGGCTGGG - Intronic
1103279463 12:119743884-119743906 CAAGATGATGACAGGGACCAAGG + Intronic
1104063258 12:125285710-125285732 CATGTTGCTACCAGGGATCTGGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105411735 13:20177038-20177060 CAAGCACCTGACAGGGATCTGGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105620123 13:22058575-22058597 GAAGACGCTGCCAGGGATGTTGG - Intergenic
1106127158 13:26909952-26909974 CAAGATGCTGAGGGCAATCTAGG - Intergenic
1106349914 13:28920674-28920696 AAAGATGCTGCCTGGGAGCTAGG + Intronic
1107123976 13:36824689-36824711 TAAGATGCTGTCAGGTAACTGGG + Intronic
1107838645 13:44434021-44434043 CAAAATGGTGACAGGTAGCTGGG - Exonic
1110685653 13:78370501-78370523 CAAGATGGTGACAGGGAATATGG - Intergenic
1110781477 13:79470747-79470769 CAAGATGAAGACAGAGATCAGGG + Intergenic
1111091468 13:83452807-83452829 CAGGATGCTGACAGGTTCCTAGG + Intergenic
1111389521 13:87574599-87574621 CATGGTGCAGACAGGAATCTTGG - Intergenic
1112239316 13:97665254-97665276 GAAGATGAAGGCAGGGATCTGGG + Intergenic
1112720791 13:102242426-102242448 CCAGATGCTGACCCTGATCTTGG - Intronic
1114333123 14:21658079-21658101 TAATATGCTGAAAGGGATTTAGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114585212 14:23805479-23805501 CAAGAGGCTGACATGGAAGTAGG + Intergenic
1114617333 14:24075308-24075330 CAGGATTCTCCCAGGGATCTGGG - Intronic
1114818931 14:25992704-25992726 CAAGATATTGAAAGGGGTCTTGG + Intergenic
1115304292 14:31917957-31917979 CACTATGCTGACATGGATCTCGG - Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121510545 14:94509844-94509866 AAAGATGATCACAGGGATCAGGG - Intronic
1122564221 14:102640426-102640448 CAAGATGATGACAGGTATCTTGG + Intronic
1123047491 14:105526197-105526219 CCAGGAGCTGACAGGGATGTAGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124127794 15:26953421-26953443 CAAGGAGCTGAGAGGGATATAGG - Intergenic
1125391706 15:39199636-39199658 CAAGATGTTGACAGGGCTGCAGG + Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127858938 15:62976923-62976945 TCAGATGCTGAGAGGGGTCTGGG + Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131194433 15:90344165-90344187 CAGGATGCTGTCAAGGACCTGGG - Intergenic
1131864276 15:96690427-96690449 CAAGATGCTGACAGTTAGCATGG + Intergenic
1132873213 16:2124656-2124678 CCAGATGCTGAGTGGGGTCTGGG + Intronic
1133536085 16:6703798-6703820 CAAGCTGCTGACTGCCATCTGGG + Intronic
1134356838 16:13490229-13490251 CAATATGCTGACTGGAATGTTGG + Intergenic
1134552300 16:15143835-15143857 CCAGATGCTGAGTGGGGTCTGGG + Intergenic
1135348591 16:21710054-21710076 CAAGATGATGACCTGGCTCTTGG - Exonic
1137928612 16:52565323-52565345 CAACATGCTGACACTGAACTTGG + Intergenic
1138953747 16:61945793-61945815 CAAGCTGTTTACAGGGAACTAGG + Intronic
1141291581 16:82722773-82722795 CAAGATGCTCACAGGGTACCAGG + Intronic
1141860696 16:86714229-86714251 GAAGATGCTGGCAGGGCTGTGGG + Intergenic
1142382285 16:89739697-89739719 CCAGCTGCTGACAGGTACCTGGG - Intronic
1142435557 16:90054765-90054787 CTCGAGGCTGCCAGGGATCTGGG - Intergenic
1143610289 17:8014073-8014095 CAGGTTGCTGACAAGCATCTGGG - Intronic
1144028413 17:11298792-11298814 CTAGCTGCTGACAGTGAACTTGG - Intronic
1144282375 17:13738953-13738975 CAAGAATCTGACTGGCATCTTGG + Intergenic
1146414391 17:32618467-32618489 CCACATCCTGACAGGGATCAAGG + Intronic
1147025429 17:37578631-37578653 CAGGGTGCTGGGAGGGATCTTGG - Intronic
1149166940 17:53763018-53763040 CTCGATTCTGACAGGGATCAAGG - Intergenic
1149629366 17:58109372-58109394 CAAGATGTTGGCAGGGAGCCAGG - Intergenic
1154962736 18:21326410-21326432 CAAGATGGTGTCAGGGACCCAGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157415146 18:47496167-47496189 CAAGATGTTGACAGGGAGAAAGG - Intergenic
1159057584 18:63481545-63481567 TAAGAAGCTTTCAGGGATCTGGG + Intronic
1160702880 19:517131-517153 CATGAAGCTCACAGGGATGTGGG + Intronic
1166349829 19:42191309-42191331 CAAGGTGCTGACACAGAGCTGGG - Intronic
1166686072 19:44797043-44797065 CAGCAGGCTGACAGGGACCTCGG + Intronic
1167735412 19:51291619-51291641 CAAAATGATGACAGAAATCTGGG + Intergenic
926664380 2:15504340-15504362 CAAGAAGGTGTCAAGGATCTTGG + Intronic
927062705 2:19439536-19439558 CAAGATGACCACAGTGATCTAGG - Intergenic
928620622 2:33084361-33084383 CATGAAGCAGACAGGGTTCTGGG + Intronic
928933327 2:36648253-36648275 CAAGTTGCAGGCAGGGATGTGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
932408520 2:71530406-71530428 AAAGATGCTGGCAGGGACCCAGG - Intronic
932967814 2:76498539-76498561 CATGATGCAGACAGGGATCTGGG - Intergenic
933221873 2:79700008-79700030 CAAGATGCTGCCAGGAATTCAGG + Intronic
934146642 2:89101244-89101266 AAAGATGTTAACAGGGATCTTGG - Intergenic
934222624 2:90099348-90099370 AAAGATGTTAACAGGGATCTTGG + Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937167773 2:119836987-119837009 CAGGAAGCTGACAGGCTTCTGGG + Intronic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
940073101 2:149711431-149711453 GAAGATTCTCACAGGGTTCTGGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940291455 2:152081356-152081378 CAAGATACTGACAGAGAGCTGGG + Intronic
943433880 2:187839047-187839069 CAAGATGCTGACATGGCCATAGG - Intergenic
943673782 2:190696302-190696324 CATTATGTTGTCAGGGATCTGGG - Intergenic
943760296 2:191600799-191600821 TAAGATTCTCAAAGGGATCTGGG - Intergenic
944452948 2:199861599-199861621 CATGATGATGACAGTGATGTAGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946283976 2:218688693-218688715 CCAGATCCTGAAAGGCATCTTGG + Exonic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947983471 2:234429074-234429096 GAAGATGCAGACAGGGAACTGGG - Intergenic
948705581 2:239790272-239790294 TAAGATGCTGGCAGGGTGCTGGG - Intronic
1170373194 20:15672041-15672063 CAGGATGCTGAGAAGGATCCAGG + Intronic
1170812775 20:19687614-19687636 CAAGATGCTAACATAGAACTTGG - Intronic
1171970483 20:31562002-31562024 TGAGATGCTGAAAGGGTTCTGGG - Intronic
1172790663 20:37503252-37503274 CCAGATGTTGACAGGCTTCTGGG - Intronic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173382628 20:42559936-42559958 CAGGATGCTGAAAGAGAGCTCGG - Intronic
1173971542 20:47156463-47156485 CAAGATGCAGCCAGGGCTTTAGG + Intronic
1175262397 20:57682775-57682797 CTAGATGCTGCCTGGGAGCTGGG + Intronic
1176340698 21:5692636-5692658 CAAGATCATGACAGGCATCTGGG + Intergenic
1176472952 21:7124789-7124811 CAAGATCATGACAGGCATCTGGG + Intergenic
1176504129 21:7631820-7631842 CAAGATCATGACAGGCATCTGGG - Intergenic
1177591562 21:23176343-23176365 CAGGAAGCTCACAGGGATCAAGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1180080913 21:45487177-45487199 CACGGTGCTGATGGGGATCTTGG + Intronic
1180183625 21:46128981-46129003 CAGGAAGCTGGCAGGGAGCTAGG - Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1180974626 22:19841179-19841201 CAAGATGCTGACAGGAAAAAGGG + Intronic
1182073554 22:27479458-27479480 CAGGATGGTGACAGGGGGCTGGG - Intergenic
1182785868 22:32907169-32907191 TAAAATGCTTACAGGAATCTGGG - Intronic
1184631242 22:45781641-45781663 CAAGATGATGACATGGATGTTGG + Intronic
1184865855 22:47201616-47201638 CAAGAGGCAGACAGGCTTCTGGG - Intergenic
1203239961 22_KI270733v1_random:7094-7116 CAAGATCATGACAGGCATCCGGG + Intergenic
949733457 3:7142711-7142733 CAAAATGTTGACAGGGATCAAGG + Intronic
950256347 3:11509904-11509926 CAGGATCCTGATAGTGATCTTGG + Intronic
950791445 3:15475376-15475398 CCAGAGCCTGACAGAGATCTGGG + Intronic
950969371 3:17170793-17170815 CAAGATGATGCCAGGGTTCTGGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951427478 3:22564360-22564382 CATGATGCCAACAGGAATCTAGG - Intergenic
952011397 3:28904197-28904219 GGAGATGCTGACACAGATCTTGG - Intergenic
952514521 3:34090687-34090709 GAAAATGCTAGCAGGGATCTGGG - Intergenic
955079512 3:55645523-55645545 CAAGCTGATGAAAGGGATTTTGG - Intronic
956585613 3:70861327-70861349 TTAGACTCTGACAGGGATCTGGG - Intergenic
957962593 3:87277320-87277342 CTAGATGCTGACAGTATTCTAGG + Intergenic
958074516 3:88658327-88658349 CAACATGGTGACAGGAATCTGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958429961 3:94028182-94028204 TGACATGCTGACTGGGATCTGGG - Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
961358373 3:126352692-126352714 CAAGATGCTGTCCTGGCTCTCGG + Exonic
962830609 3:139135984-139136006 CAAGATGGTGTGTGGGATCTAGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
964686829 3:159404662-159404684 CAAGATGCTGTCTGGGAGCTAGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967446018 3:189567428-189567450 CATGATTCTGTCAGGGAACTTGG - Intergenic
968169604 3:196499364-196499386 CAAGATGCTAGCAGGGAGCAGGG - Intronic
969077731 4:4593525-4593547 AGAGAGGCTGACCGGGATCTTGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
973068097 4:45822336-45822358 ATAGATGTTGACAGGGATGTGGG + Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
975639815 4:76489068-76489090 CAAAGTGCTGGCAGGGACCTGGG - Intronic
975645199 4:76538916-76538938 CAATATGATGACAGTGATCAAGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978108160 4:104930144-104930166 CATGATGCTGTCAAGGATATAGG - Intergenic
979715358 4:123831071-123831093 CTAGAGGAAGACAGGGATCTAGG - Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
987295354 5:16545638-16545660 AAGGAAGCTGACAGGGAGCTTGG - Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988729341 5:33954906-33954928 CAAGATCATGACAGACATCTTGG - Intronic
989271418 5:39537895-39537917 CAAGATGCTGGCTGTGGTCTTGG + Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989731237 5:44652247-44652269 GGAGATGCTGCCAGGGATGTTGG + Intergenic
990155317 5:52870615-52870637 CTAGCTGCTGACAGGGAAGTCGG + Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
992378022 5:76209013-76209035 CAAGCTGCTGACTGAGCTCTGGG - Intronic
993686996 5:90949999-90950021 TAAGATGCTGATAGGGATCATGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994660564 5:102648921-102648943 GAAGATGCTCTCAGGGATCCAGG + Intergenic
995979390 5:118082756-118082778 CAAGATGTAGACAGGGATTCAGG - Intergenic
996131149 5:119782339-119782361 CATGAGCATGACAGGGATCTGGG - Intergenic
996809336 5:127497419-127497441 CCAAATGCTGACAAGGATGTGGG + Intergenic
1001267346 5:170283499-170283521 CAAGATCCTGCCAGTGAGCTAGG - Intronic
1001695634 5:173667796-173667818 TAAGAGGCTGACAGTCATCTAGG + Intergenic
1004021515 6:11780069-11780091 CAAGATGCTGACAGAGTGCCTGG + Intronic
1004525713 6:16405494-16405516 CAAAATGCTCTCAGGGAGCTGGG + Intronic
1004625127 6:17367881-17367903 CAACATGATAACAGGGATCTAGG - Intergenic
1005155629 6:22802885-22802907 CAAAATGGTGACTGGAATCTAGG + Intergenic
1006290148 6:33128659-33128681 CAAGATGCTGACAGGAGCCAGGG + Intergenic
1006297759 6:33177599-33177621 CAGGATGCTGGCAGGGACCTCGG + Intronic
1006633471 6:35445959-35445981 ACAGCTGCTGACAGGGATCACGG + Intergenic
1009307016 6:62103244-62103266 CAAGAGGCAGACAGGTTTCTAGG - Intronic
1010323260 6:74538030-74538052 CTAGAAGCAGACAGGGATGTTGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011402289 6:86976571-86976593 CAAGATGGTGAAAGAGTTCTTGG + Intronic
1012593064 6:101006320-101006342 GAAGATGGAGACAGAGATCTGGG + Intergenic
1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG + Intronic
1017380289 6:153820625-153820647 GAAGATGCTGGCAGCCATCTTGG + Intergenic
1018711342 6:166500026-166500048 CAAGATGCAGTCAGAGAGCTTGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019232298 6:170577783-170577805 CAGGATGATTATAGGGATCTTGG + Intronic
1021471180 7:21003574-21003596 AAATATGCTGAAAGGGACCTGGG + Intergenic
1021799630 7:24291436-24291458 CACGATGTTGACAGGCGTCTTGG - Intronic
1024087258 7:45904297-45904319 CAAGCTGATGAAAGAGATCTAGG + Intergenic
1024219427 7:47276440-47276462 CAAGCTCCTGTCAGGGAGCTGGG - Exonic
1026129091 7:67605745-67605767 CAAGAGGCTGGCAGGGAAGTGGG + Intergenic
1028201553 7:87967865-87967887 CAAGGTGCTTACAGAGATATTGG + Intronic
1029024144 7:97397493-97397515 GAAGAAGCTAACAGGGAACTAGG - Intergenic
1029952943 7:104606405-104606427 CAACAAGCTGACAGAGGTCTGGG + Intronic
1030085418 7:105811589-105811611 CAGGCTGCTGACAGGAGTCTGGG + Intronic
1030581895 7:111367100-111367122 GAATATGCTGACAGTGTTCTCGG + Intronic
1030841751 7:114361984-114362006 AAAAATGCTGAAAGGGAACTTGG + Intronic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031478365 7:122249326-122249348 GAAGATGAAGGCAGGGATCTGGG + Intergenic
1031922953 7:127614767-127614789 CAAGCTGGTGACAGGGCTCCTGG - Intronic
1034396911 7:150833260-150833282 AAAGGACCTGACAGGGATCTAGG - Intronic
1034890258 7:154833219-154833241 CAATATGCTGGCAGGGCACTGGG - Intronic
1036219122 8:6906112-6906134 AAAGATTCTGCCAGGGATCCAGG - Intergenic
1036989059 8:13570936-13570958 CATGGTGCAGACAGGTATCTTGG + Intergenic
1037804991 8:22054140-22054162 CATTTTGCTGCCAGGGATCTGGG - Intronic
1038200848 8:25411284-25411306 CAAGATCCTTACTGGGATCCAGG - Exonic
1040566003 8:48568108-48568130 ACAGATGCTGACAAGGATGTGGG + Intergenic
1040673664 8:49722774-49722796 CCCGATGATGACAGGGGTCTAGG - Intergenic
1041791513 8:61701004-61701026 CTAGATCTTGATAGGGATCTGGG - Intronic
1043205404 8:77432664-77432686 CTAGAGGCTGTCAGGGATTTGGG - Intergenic
1043977745 8:86601915-86601937 GAAGCTGCTGTCAGGAATCTAGG + Intronic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1045812435 8:106238513-106238535 CAAGATGATGGCAGAGATCAGGG + Intergenic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046285658 8:112090224-112090246 CCAGATACTGTCAGGGTTCTTGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047413238 8:124641278-124641300 CAAGTTGCTCACAGGTATATGGG - Intronic
1048662510 8:136621145-136621167 AAAGATGCTGACAGGCATTAAGG + Intergenic
1048784979 8:138040937-138040959 CCAGATGCTGACAGATTTCTTGG - Intergenic
1049040123 8:140106304-140106326 AAAGTTGCTGACAGGTACCTAGG + Intronic
1049815120 8:144595639-144595661 CAAGAGGCAGGCAGGTATCTGGG + Intronic
1050245430 9:3684600-3684622 CTAGATGTTGACAAGGACCTTGG + Intergenic
1056534624 9:87516855-87516877 CAGGGTGCTGGCAGGGAACTGGG + Intronic
1057426145 9:94951335-94951357 CAAGATGGGGACCTGGATCTTGG + Intronic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059464420 9:114458713-114458735 CATGATGCAGACACAGATCTAGG - Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1060244909 9:121936990-121937012 CAAAATGCAGACAAGGATTTTGG + Intronic
1061556495 9:131373267-131373289 CAAGATGCTGACAGGAGCTTTGG - Intergenic
1062364846 9:136203630-136203652 CCAGATGCTAACAGGCTTCTGGG + Intronic
1203422369 Un_GL000195v1:5357-5379 CAAGATCATGACAGGCATCTGGG - Intergenic
1186402065 X:9269286-9269308 CAGGGTTCTGAAAGGGATCTGGG + Intergenic
1187583220 X:20631543-20631565 CATGCAGCTGACAGGGTTCTAGG - Intergenic
1187744977 X:22399470-22399492 AAAGTTGATGACAGTGATCTAGG + Intergenic
1187753272 X:22491126-22491148 AAACATGCTGACAGTGATCCTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1195015570 X:100776706-100776728 AAAGATGCTAACAGGGGTCAGGG - Intergenic
1197150664 X:123217030-123217052 AAAGGTGCTGACAGGGACCATGG + Intronic
1199323997 X:146476242-146476264 GGAGAGGCTGACAGGGCTCTGGG - Intergenic
1199558223 X:149132687-149132709 CAAGATGCTGAGTCAGATCTGGG - Intergenic
1199977202 X:152901066-152901088 AGAGATGCTGACTGGGATGTGGG + Intergenic
1200384367 X:155874904-155874926 CAAGATGGGGACAGGGAGCATGG - Intergenic
1200817392 Y:7547899-7547921 CAAGATGATGAAAGGGACATGGG - Intergenic