ID: 1090130943

View in Genome Browser
Species Human (GRCh38)
Location 11:124141623-124141645
Sequence GCTGAGATGCAGAAGGAGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 687
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 614}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090130943_1090130952 22 Left 1090130943 11:124141623-124141645 CCGTCCTCCTTCTGCATCTCAGC 0: 1
1: 0
2: 5
3: 67
4: 614
Right 1090130952 11:124141668-124141690 TAAGGCCAAGACATTCCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 135
1090130943_1090130951 4 Left 1090130943 11:124141623-124141645 CCGTCCTCCTTCTGCATCTCAGC 0: 1
1: 0
2: 5
3: 67
4: 614
Right 1090130951 11:124141650-124141672 AGGGGAACTTATGTGTTATAAGG 0: 1
1: 0
2: 1
3: 13
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090130943 Original CRISPR GCTGAGATGCAGAAGGAGGA CGG (reversed) Exonic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900717867 1:4156765-4156787 GCTGAGATGCAGACTGACCAGGG - Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900871911 1:5310451-5310473 GCTGAGATGTCCAAGGTGGAGGG + Intergenic
901452483 1:9344565-9344587 GTTGAGAGGCGGCAGGAGGAGGG + Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
902043745 1:13510642-13510664 GCACAAATGCAGGAGGAGGAGGG + Intronic
902682733 1:18055112-18055134 GCTGAAATGCTGAAGCAGAATGG - Intergenic
902768871 1:18634268-18634290 GGGGAGATGCAGAAGGAGAGAGG - Intronic
903443098 1:23402928-23402950 GCTGAAATGTGGAAAGAGGAAGG + Intronic
903875736 1:26472171-26472193 GCTGGGTTGCATAAGGTGGAAGG + Intergenic
904001018 1:27338803-27338825 GCTGTGATGCGAAAGGAGAATGG + Intergenic
904014388 1:27408805-27408827 GGTGAGATGATGAAGGGGGAGGG + Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904804592 1:33121816-33121838 GCTGAGATACTGAAGCAGGATGG - Intergenic
905150962 1:35927112-35927134 AGTGAGCTGCAAAAGGAGGAAGG + Exonic
906225583 1:44118926-44118948 GCTGAGATGGAACAGGAGGCTGG + Exonic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906726406 1:48047676-48047698 ACTGAGATGGAGGAGGATGAGGG + Intergenic
906937748 1:50229202-50229224 GCTGAGATGTGGAATGAGCAGGG + Intergenic
907689188 1:56645391-56645413 GCTGAGAAGCAGAAGCACGACGG + Exonic
908001982 1:59689269-59689291 GCAGAGAAGCAGCAGGAAGAGGG + Intronic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
908633183 1:66133147-66133169 ACTCAGATACAGAAGCAGGAAGG + Intronic
909457371 1:75865514-75865536 GTCGAGAGGCAGAAGGAGCAAGG + Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909939342 1:81592501-81592523 GCTGAGATTCGGGAGGTGGATGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910287397 1:85570948-85570970 GCAGAAATGTAGAAAGAGGACGG + Intronic
910819255 1:91328531-91328553 GATGTGCTGCAGAACGAGGAGGG + Intronic
912620623 1:111153123-111153145 GCTGGGATGGGTAAGGAGGAGGG - Intronic
912841603 1:113043993-113044015 GCTGAGGTGGAGTAGGGGGAGGG + Intergenic
912860416 1:113209208-113209230 GATGGCATGCAGAAGGAAGAGGG + Intergenic
913184679 1:116359224-116359246 GCTGAGATTCAGAGGGATTATGG - Intergenic
915212672 1:154322214-154322236 GGAGAGATACAGAAAGAGGAGGG - Intronic
917223810 1:172760475-172760497 GCTGTGAACAAGAAGGAGGATGG + Intergenic
917274046 1:173311728-173311750 GGAGAGATGCTGGAGGAGGAAGG - Intergenic
919567459 1:199206853-199206875 GCAGAGATGCAGAAGATGGAAGG + Intergenic
920058035 1:203206744-203206766 TCTGAGATGCAGAATGAAAAAGG - Intergenic
920341898 1:205280357-205280379 GCTGAGGCTCAGAAGGATGAAGG + Intergenic
920449398 1:206047806-206047828 CCTAGGATGCAGAAGGAGGGAGG - Intronic
921096752 1:211893405-211893427 GCTGAGATGGGGAATGAGGGAGG + Intergenic
921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG + Intergenic
921177086 1:212604913-212604935 GCTGTGATGGGGAACGAGGATGG + Intronic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
921412288 1:214848759-214848781 GCTGAAAGGCAGGAGGAAGATGG - Intergenic
921993827 1:221396073-221396095 GAAGAGATGGACAAGGAGGAAGG - Intergenic
922214144 1:223507041-223507063 GCTGGGAAGAAGATGGAGGATGG + Intergenic
922555555 1:226529710-226529732 GATGAGTGGCAGAAGTAGGATGG + Intergenic
922559141 1:226555431-226555453 GCTGAGATGGGGAAAGAGGAGGG - Intronic
922914929 1:229249455-229249477 GCTGAGGTGCAGATGCACGAAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923146581 1:231202791-231202813 GCTGAGAAGCAGGAGGAGCCTGG + Intronic
924184704 1:241475953-241475975 GCAAAGATCAAGAAGGAGGAAGG - Intergenic
924486430 1:244487779-244487801 GCAGAGAGGCAGCAGGAGGCGGG + Intronic
1062922844 10:1293036-1293058 GAAGAGATGCAGAGGGAGGGAGG + Intronic
1063636543 10:7788025-7788047 GCTGAGAGGCGGAAGGAGGTGGG + Intergenic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1064924442 10:20554739-20554761 TCTGAGAAGGAGAAGGATGAAGG - Intergenic
1065268235 10:23999556-23999578 GCAGAGATGGGGAAGGCGGAGGG + Intronic
1065293393 10:24253103-24253125 GCTGAGACCCAGAGGAAGGAAGG + Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065997705 10:31074677-31074699 GCTGAGAAGCTGAAGAAAGAGGG + Intergenic
1067031661 10:42882192-42882214 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1067279519 10:44860805-44860827 ACTGAGATTCAGAAAGAGAAAGG - Intergenic
1067972998 10:50992523-50992545 GTTGGGATGAAGAAGGCGGAGGG + Intronic
1067991467 10:51217930-51217952 CCTGAGATTCAGATGAAGGAGGG - Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069736266 10:70656726-70656748 GCTGGGATGCAGAGAGCGGAAGG + Intergenic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1070739906 10:78895892-78895914 GCGGAGATGGAGGCGGAGGAAGG - Intergenic
1071163755 10:82781153-82781175 TCTGAGATGTGGAAAGAGGAAGG - Intronic
1071230858 10:83582902-83582924 GGTGAGATGAAGAAGGCAGAGGG + Intergenic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1071718835 10:88122707-88122729 GCAGGGATGGAGATGGAGGAGGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1073442361 10:103559629-103559651 GCTGAGATGCAGACAGATGAAGG - Intronic
1073779888 10:106825612-106825634 GCTGGGATGCAGAAGGTGATGGG - Intronic
1074228966 10:111514807-111514829 GCTGAGATCCACATGGATGAAGG - Intergenic
1074400712 10:113139284-113139306 GCTGAGGTGGAGAAGGAAAAGGG - Intronic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074849403 10:117427076-117427098 GCTGAGATGCAGGAGGAATGAGG + Intergenic
1075144121 10:119868895-119868917 GCTGGGATGGAGTATGAGGAGGG + Intronic
1075271384 10:121054644-121054666 GGAGAGATGCTGCAGGAGGAGGG - Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075306103 10:121368764-121368786 GTTGAGGTGCAGAAGTGGGAAGG - Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075605893 10:123807659-123807681 GCTTAGATGGAAAAGGAGGAGGG + Intronic
1075991888 10:126845101-126845123 GCTGAGAGCCATAAGGATGATGG - Intergenic
1076367985 10:129934506-129934528 CCTGAGATGAGGAAGCAGGAGGG - Intronic
1076468693 10:130703684-130703706 CCTGAGAGGCAGTAGGAAGAAGG + Intergenic
1076566036 10:131400235-131400257 GATGAGATGCAGAAGCAGTGAGG + Intergenic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1078456331 11:11478534-11478556 GCCCAGATGCAGCAGAAGGATGG + Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG + Intronic
1079499576 11:21087638-21087660 GCTGAAATGCAGCAGGAAGGAGG + Intronic
1080048210 11:27831690-27831712 GCTGAGATGTAGTAGGAAAATGG + Intergenic
1081022243 11:37960528-37960550 GCTGATATGGAGAAGGCTGAGGG + Intergenic
1081434527 11:43012406-43012428 GATGAGATGAAGAATGAGAACGG + Intergenic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1083313050 11:61795512-61795534 GATGTGCTGCAGAATGAGGAGGG + Exonic
1083448857 11:62728870-62728892 GCTCAGCTGTACAAGGAGGAAGG + Exonic
1084359899 11:68662447-68662469 GCTGAGATCCAGAGGGAAGTGGG + Intergenic
1085502887 11:77039174-77039196 GCTGAGAAGGACAAGGAAGAAGG + Intronic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1086932706 11:92709770-92709792 GCTGATATGCAGAACAGGGAAGG + Intronic
1086973403 11:93107165-93107187 GCTGAGAGACAGAAGCTGGATGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087965064 11:104402959-104402981 GCTGATTAGCAGAAGGAGGTGGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1089937291 11:122377329-122377351 GCTGAAATGCTGAAGGAGGCGGG + Intergenic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090097456 11:123756929-123756951 TGTGAGATGCAGAGGGAGGTGGG + Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090620185 11:128553695-128553717 GCTGAGGAGGAGGAGGAGGAGGG - Intronic
1091337880 11:134786131-134786153 TCTGAGATGCAGGAGGAAGGGGG - Intergenic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1092260839 12:6952545-6952567 GGTGAGGGGCAGACGGAGGAAGG - Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1092732220 12:11545645-11545667 GCTGAGTGGCAGGGGGAGGAAGG - Intergenic
1093744227 12:22721555-22721577 GAAGAGATGGAGAAGCAGGAGGG + Intergenic
1094058086 12:26286463-26286485 GCTGGGAGGCAGCAGGAGAAAGG + Intronic
1095949505 12:47773993-47774015 GCTGAGACCCACAGGGAGGACGG + Intronic
1098562341 12:71888733-71888755 GCTGAGATTGAGAAAGAGTAGGG - Intronic
1099519473 12:83642480-83642502 GCTGAGATGCAAAAGAAGCAGGG - Intergenic
1100766744 12:97874600-97874622 GCTGAGGAGGAGAAAGAGGAAGG - Intergenic
1101564896 12:105895860-105895882 GCTGTGATCCAGTAGGGGGAAGG - Intergenic
1101698477 12:107149450-107149472 GCTGAGATGGAGAAGGGACATGG - Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101808504 12:108087011-108087033 GATGAGACAGAGAAGGAGGAAGG - Intergenic
1102734557 12:115146861-115146883 GCTGACATGCAGTAGGAGCTTGG + Intergenic
1102866312 12:116377689-116377711 GCTCAGATATAGATGGAGGAGGG - Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1102923885 12:116812335-116812357 GCAGAGATGCAGGCAGAGGACGG + Intronic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1104053793 12:125214277-125214299 GCTGAGAGACAGAGGGAGGCTGG - Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104252956 12:127113311-127113333 GCTGGGAGGCAGAAGGAGGCTGG + Intergenic
1105775918 13:23659964-23659986 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
1107096767 13:36545722-36545744 GGAGAGATGCAGAAGAAGGCAGG + Intergenic
1107148555 13:37086200-37086222 GGTGAGAAGGAGAAAGAGGAGGG + Intergenic
1108346432 13:49551153-49551175 GCAGGGAGGGAGAAGGAGGAAGG + Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1109179673 13:59199104-59199126 TCAGAGATGTAGAAGAAGGATGG + Intergenic
1110619140 13:77576091-77576113 GCTGAGATGGAAAGAGAGGAAGG - Intronic
1110634414 13:77749611-77749633 GCTGAGATGCAGCAGGAAACTGG - Intronic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1111604586 13:90520588-90520610 GCTAGGAGGCAGTAGGAGGAGGG - Intergenic
1112750291 13:102576346-102576368 GCAGAAATGCAGAAGGAGCCTGG + Intergenic
1113029595 13:105978416-105978438 GCTGAGATTCAGAGACAGGAGGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113468985 13:110531142-110531164 GCACAGATGGAGAAGGAGGTGGG + Intronic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113640239 13:111952162-111952184 GCTGAGCTGCAGCAGGACGGTGG + Intergenic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116663797 14:47748719-47748741 ACTGAGATGGAGGAGGAAGAAGG - Intergenic
1116665124 14:47764850-47764872 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1117679293 14:58186868-58186890 GGTGAGAAACAGAAGGAGGCAGG + Intronic
1118325419 14:64777295-64777317 GCTGAGTTTCAGAAGCAGGCAGG + Intronic
1118347108 14:64948400-64948422 GCAGAGCTGGAGGAGGAGGAGGG - Exonic
1118375031 14:65169426-65169448 GCTGAAATGAAGAAGGAGGCTGG + Intergenic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1118758545 14:68863468-68863490 GCAGAGGTGCAGAAGATGGAAGG + Intergenic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119055710 14:71417643-71417665 GCAGAGGTGGAGGAGGAGGAAGG + Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119601686 14:75980952-75980974 GCAGACGTGCAGAAGGAGGGAGG + Exonic
1119878961 14:78085045-78085067 GCTGAGATGCAGAGAGAGTAAGG - Intergenic
1120656333 14:87194423-87194445 GCTGAGATGAAAAAGCAGAAAGG + Intergenic
1120886864 14:89458539-89458561 GCTGAGATACAGAAGGAATGGGG - Intronic
1121348649 14:93155142-93155164 GCTGAGCTGCAGAAGCAGCTTGG - Intergenic
1122150242 14:99721754-99721776 ACTGAGGTCCAGAAGGAGAAGGG - Intronic
1122577030 14:102749231-102749253 GCTGAGCTGCAGGAGGAGTGAGG - Intergenic
1125594566 15:40876070-40876092 GCAGAGGTGGAGAAGGTGGAAGG + Intergenic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1126750615 15:51873136-51873158 GATGAGATGAAGAGAGAGGAAGG - Intronic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1126849257 15:52787610-52787632 GCTGAGATGGAGGTGGAGGTGGG + Intronic
1126878286 15:53067476-53067498 GCTGATTGGCAGAAGGAGGCTGG + Intergenic
1127055225 15:55124724-55124746 GCTGGGATGCAGAAGATGCAGGG + Intergenic
1127982324 15:64044519-64044541 GCTGAGATCCAGAAAGGGGAAGG + Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1128664837 15:69530544-69530566 GCTGAGACACAGAAGGAAGTGGG + Intergenic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1130078497 15:80710474-80710496 GCTGATATGTCGAGGGAGGAAGG + Intronic
1130106295 15:80931139-80931161 CCTGAGACCCAGAAGGAGGTGGG - Intronic
1130537946 15:84800271-84800293 GCTGTGAAGCAGAAAGAGAATGG - Intronic
1130740803 15:86597732-86597754 GCAGAGATGCAGAAGCAGTTAGG + Intronic
1130815378 15:87426579-87426601 GCTGATATGCAGATGGCAGAAGG - Intergenic
1130819547 15:87479919-87479941 GCTCAGCTACAGAAGGAGCAGGG - Intergenic
1131140366 15:89972242-89972264 GCTGAGCCTCAGAAGAAGGAAGG - Intergenic
1131152225 15:90054298-90054320 GATGGGATGGAGAAGGCGGAGGG + Intronic
1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG + Intronic
1131604317 15:93884932-93884954 GCTGAGGTCCAGAAGGTGAATGG - Intergenic
1131843962 15:96469164-96469186 CCTGAGATTCAGAAAGAGGGTGG + Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132330695 15:101010428-101010450 CCTGCGATGGAGAAGAAGGAAGG - Exonic
1132650437 16:1019115-1019137 GCTGGGCTCCAAAAGGAGGAGGG - Intergenic
1132672121 16:1106295-1106317 GCTGGGACACGGAAGGAGGAGGG - Intergenic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1133209845 16:4257494-4257516 GCCGAGATGGGGAAGGGGGAGGG + Exonic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133532812 16:6671547-6671569 TCTGAGATGCAGAAAGACTAAGG - Intronic
1133598523 16:7316720-7316742 GCTGAGATGGAGTGGGAGGTAGG + Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1134046141 16:11102705-11102727 GCTGAGATGGAGAAGGGGCCTGG - Intronic
1134419591 16:14072695-14072717 GCAGAGATACAGACGGAGGTTGG + Intronic
1134674430 16:16079440-16079462 GCTGAGATGGACAAAGTGGAGGG + Exonic
1134692083 16:16197673-16197695 GGAGAGATGCAGGAGGAGGGAGG + Intronic
1134818866 16:17229315-17229337 GGTCACATGCACAAGGAGGATGG - Intronic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1136518506 16:30782048-30782070 CCTGAGATGCTCCAGGAGGACGG + Exonic
1136565055 16:31064799-31064821 ACTGAGCTGAAGAAGGAAGATGG - Exonic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137253439 16:46756972-46756994 GGTGAGGGGCAGGAGGAGGAAGG + Intronic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1138930844 16:61653989-61654011 GCTACGATGATGAAGGAGGAGGG - Exonic
1139244593 16:65429130-65429152 AGTGAGATGCTGAAGGAAGAAGG + Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1139572602 16:67822539-67822561 GCACAGATGCATAAGGAGGGAGG + Intronic
1139790848 16:69433529-69433551 GCTGTGGTGAAGGAGGAGGAGGG - Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140286742 16:73610049-73610071 GCTGAGATGAAGAGGAACGAGGG - Intergenic
1140408728 16:74728351-74728373 GCTGAGATCCAGAGGCAGAATGG + Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141744 16_KI270728v1_random:1771553-1771575 GCTGGGATGATGGAGGAGGAGGG - Intergenic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143334162 17:6159842-6159864 GCTGAGCTGCCGAAGTGGGAGGG - Intergenic
1143542596 17:7578533-7578555 GCTGAGGAGCAGCAGGAGGGGGG + Exonic
1143732831 17:8890662-8890684 GCTGAGATGAAGCAGGGAGAGGG + Intronic
1146547536 17:33751862-33751884 GCTGAGAGGCAGCGGGAGGCTGG + Intronic
1147045321 17:37746941-37746963 GCTGAGAGCCAGAAGGAAGCGGG + Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147441732 17:40451718-40451740 GCTGAGCTGGAGAAAGAGGTTGG - Intronic
1147946815 17:44084989-44085011 GTTGAGAGCCAGAAGAAGGAGGG + Intronic
1148154008 17:45412328-45412350 TCTGAGAGGCACAAGGGGGAGGG + Intronic
1148212877 17:45818806-45818828 GATCAGATGCAGCAGGAGGGAGG - Intronic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1149139046 17:53407872-53407894 GCTGAGATGGAGAATAAGCAGGG - Intergenic
1149321500 17:55486430-55486452 GGAGAGATGCAGATGGAGGTAGG - Intergenic
1149367504 17:55960581-55960603 GCTGGGAGACAGAAGCAGGAGGG + Intergenic
1149585474 17:57783326-57783348 ACTCTGATGCAGAATGAGGAAGG + Intergenic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1150543071 17:66123419-66123441 GCTGAGCTGGAGAAGGAACAGGG + Intronic
1150635616 17:66911250-66911272 GCTGAGATGGAGAAGGTGTTGGG - Intergenic
1151562475 17:74878025-74878047 GCTCAGATGGAGCAGGGGGAAGG + Exonic
1151747092 17:76017623-76017645 GCTGGGATGGAGATGGAGAAGGG - Intronic
1151759296 17:76091446-76091468 GCTGAAATCCAGAACAAGGAGGG - Intronic
1152011667 17:77722685-77722707 GCTGAGAAGGAGGAGAAGGAGGG - Intergenic
1152353661 17:79796847-79796869 GCTGGGCTGCAGCAGGGGGAGGG + Intronic
1152468482 17:80478106-80478128 GCTGAGATGCTGAACGCAGACGG - Intergenic
1152838915 17:82553790-82553812 GCTGTGACGCAGATGGTGGATGG + Intronic
1152911235 17:83005933-83005955 CCTGAGATCCAGAGGTAGGAGGG + Intronic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1153843119 18:9024582-9024604 GCTCAGATGCAGAAGTAGAATGG + Intergenic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1155958109 18:31970964-31970986 TCTGACTTTCAGAAGGAGGATGG - Intergenic
1157190893 18:45580769-45580791 GCTGAGATTCAGACTGAGGCTGG + Intronic
1157429109 18:47608843-47608865 GCTGAGGTGTATAAGGAAGAAGG + Intergenic
1157963265 18:52180489-52180511 GCTAAAATCCAGAAGGAGAAAGG + Intergenic
1158571930 18:58603555-58603577 GCTGAGAGCCAGCAGGAGGGAGG - Intronic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1160367083 18:78335530-78335552 GGAGAGAGGGAGAAGGAGGAGGG + Intergenic
1160402235 18:78619516-78619538 GCTGTGATGGAGGAAGAGGAAGG - Intergenic
1160676594 19:394455-394477 GGAGAGATGGGGAAGGAGGATGG + Intergenic
1161021058 19:2011750-2011772 GCTGAGGAGCAGGAGCAGGAGGG - Intronic
1161746531 19:6063582-6063604 GCTGCGTTGAAGAAGGAGGGAGG + Intronic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1162134119 19:8544693-8544715 GCTGAGGTGCAGAAGTGGGTGGG + Intronic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162377119 19:10311188-10311210 GCTGAGATGCAGAACCATTAAGG + Intronic
1162725013 19:12684991-12685013 GCTGAGATGCAGAAAGATCAGGG - Intergenic
1162800900 19:13109941-13109963 GCCGAGACGCTGAAGGTGGAAGG + Exonic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1163176746 19:15569551-15569573 GATGAGAGGCAGAAGAAAGAGGG + Intergenic
1163463506 19:17453432-17453454 GCTGACAGGAAGAAGGAGGCTGG - Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164767597 19:30783764-30783786 GCTGAAGTTCAGAGGGAGGAAGG + Intergenic
1166683792 19:44782976-44782998 GCTGAGGTGCAGGGGTAGGACGG + Intronic
1166773818 19:45300414-45300436 GATGAGAGGCAAAAGGAGGTGGG - Intronic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1168231460 19:55034968-55034990 GCTGTGATGCGGCAGGAGGAGGG - Intronic
1168255569 19:55162910-55162932 GCTGGGAAGCTGGAGGAGGAGGG - Intronic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168657673 19:58142832-58142854 GATGAGAGGGAGAAGGAGAAAGG - Intronic
925083293 2:1087056-1087078 GCTAAGGAGCAGAAGGAGGGTGG + Intronic
925157935 2:1661533-1661555 GCAGGGATGCAGGTGGAGGATGG + Intronic
925662017 2:6212773-6212795 GCTGCGGTGCTGAAGGAGCATGG - Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926185685 2:10689161-10689183 GCTGAGATCCAGCAAGGGGAAGG - Intronic
926364054 2:12116664-12116686 GCTGAGAAACAGATGGAAGAAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
927076284 2:19581088-19581110 GATGGAATGCAGGAGGAGGAAGG + Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927803572 2:26123961-26123983 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
928249693 2:29664671-29664693 GCTGGGTTGCAGCATGAGGATGG - Intronic
929133696 2:38602877-38602899 GCGGAGACGGAGGAGGAGGAGGG - Exonic
930271262 2:49260301-49260323 ACTGAGATGGAGAACAAGGAAGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
930678603 2:54231482-54231504 CCTGAGATGAAGAATGAGCACGG + Intronic
931345092 2:61439273-61439295 GCTGAGGCACAGCAGGAGGAGGG - Intronic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933857283 2:86428215-86428237 GCTGAGGTGCAGAAAGAGAGAGG - Intergenic
934652389 2:96099942-96099964 GGTGAGAAGGAGAAAGAGGAAGG + Intergenic
936115507 2:109699646-109699668 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
936285454 2:111177926-111177948 GGTGAGATGAGGAAGGAGGAGGG - Intergenic
936964131 2:118110435-118110457 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
937268632 2:120633130-120633152 GCTGACATCCAGAAAAAGGAGGG + Intergenic
937377451 2:121347360-121347382 TCTGGGGTGCAGAAGCAGGAGGG + Intronic
937411461 2:121680380-121680402 GCTGAGATGAAGAAGGATATGGG + Intergenic
937623431 2:124016614-124016636 GCTGAGAGACGGGAGGAGGATGG - Intergenic
937941021 2:127286149-127286171 GCTGAGCAGCAAAAGGAAGATGG + Intronic
939045617 2:137246155-137246177 GAAGAGATCCAGGAGGAGGATGG + Intronic
939176689 2:138757298-138757320 TCTGAGATGTAGAAGGCGTAAGG + Intronic
941915922 2:170813916-170813938 GCTCAAAGGCAGAAGAAGGAGGG - Intronic
943245359 2:185442051-185442073 GCTCAGATGCAGAAATAGGATGG + Intergenic
944663957 2:201943905-201943927 GCAGAGATGGAGGAGGTGGAAGG + Intergenic
945649362 2:212539056-212539078 GCTGAGAGGAAAAAGAAGGACGG - Intergenic
946182695 2:217958477-217958499 GCTGGGATGGAGAATGACGATGG + Intronic
946237390 2:218332541-218332563 GCTGAGATGGGGAAGGAGGAAGG - Intronic
946339674 2:219059409-219059431 GCTGAGATGCCGAGGGAGGCAGG - Intronic
946400938 2:219468211-219468233 TCTGAGAAGTAGATGGAGGAGGG + Intronic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947373974 2:229476347-229476369 GCTGAGAGGCAGGGGGAGGGCGG - Intronic
947713390 2:232328365-232328387 CCTGAGATGCAGAGGAAGAAGGG - Intronic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948554461 2:238797800-238797822 GGTGTGATGCAGGAAGAGGATGG + Intergenic
948556212 2:238813267-238813289 GCTGTGAGGCTGAAAGAGGAAGG - Intergenic
949061033 2:241957443-241957465 GGTGAGAGCCAGAAGGTGGAGGG + Intergenic
1168880202 20:1199967-1199989 ACTGGGATTCAGTAGGAGGAAGG - Intergenic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169081327 20:2799282-2799304 GCTGAGATGCAAAGGAAGAATGG - Intronic
1169244779 20:4016599-4016621 GCTGAGAGGCTGCAGCAGGAGGG - Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169575166 20:6951512-6951534 GCTGTGTTGCTGAATGAGGATGG + Intergenic
1169990249 20:11495270-11495292 GGTGAGAGACAGAGGGAGGAAGG + Intergenic
1170133359 20:13046569-13046591 CCTGTGATGCAGAAGGATGTGGG + Intronic
1170280126 20:14636978-14637000 GCTGAAATGCAGAATAATGATGG + Intronic
1170766359 20:19292668-19292690 GTTGAGAGGCAGAAGCAGGTGGG + Intronic
1172189211 20:33051814-33051836 GCTAAGATGGGGAAGAAGGATGG - Intergenic
1172863484 20:38076567-38076589 GCTGAGAAGCAGAGGCAGCAAGG - Intronic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1173034338 20:39394359-39394381 GAAGATATGCAGGAGGAGGAGGG + Intergenic
1174733841 20:52945083-52945105 GCTGAGGAGGAGAAGGAAGAGGG + Intergenic
1175101100 20:56579399-56579421 GCTGAGATCCTGAAAGAGGTGGG + Intergenic
1175201831 20:57283376-57283398 TCTGAGATGGAAAAGGGGGAGGG + Intergenic
1175690191 20:61059683-61059705 GGTGAGAAACAGAAGGAGTAGGG - Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1178794149 21:35728106-35728128 GCAGAGATGGAGGAGGTGGAAGG - Intronic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179162294 21:38908575-38908597 GCTGAGAGGCATAAGGCAGATGG - Intergenic
1179286703 21:39983816-39983838 GATGTGGTGCAGAAGGGGGAAGG - Intergenic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179837808 21:44049032-44049054 CCTGAGATGAAGCAAGAGGAGGG - Intronic
1180075424 21:45459279-45459301 GGTGAGGGGCAGGAGGAGGAGGG + Intronic
1181636905 22:24178746-24178768 CCTGAGATGCTGGAGAAGGAGGG - Intergenic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1183232337 22:36590831-36590853 GCAGAGATGCACAGGGAGGGAGG - Intronic
1183645452 22:39123766-39123788 GCAGAGGAGCACAAGGAGGAAGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
1183929875 22:41229870-41229892 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1184109911 22:42388619-42388641 GCTCAGAGGCAGGAGGAGGGCGG + Intronic
1184583361 22:45431351-45431373 GGTGAGACCCAGGAGGAGGATGG + Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184920417 22:47601618-47601640 GGAGGGATGGAGAAGGAGGAGGG - Intergenic
1185210691 22:49569056-49569078 GCTGAGGTGCAGGAGGAGCCGGG - Intronic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
950773365 3:15330028-15330050 GCAGGGAAGCAGAAGGAGGCGGG + Intronic
950799991 3:15542858-15542880 GCTGAGATGTGGAAGGAAGGTGG + Intergenic
951850795 3:27138040-27138062 GGAGGGATGCTGAAGGAGGATGG + Intronic
952210186 3:31222472-31222494 ACTGTGGTGCAGAAGGAGGGAGG - Intergenic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952419049 3:33114700-33114722 GTTGAGATGAAGAAGGAGACAGG - Intronic
952732125 3:36649599-36649621 GAAGAGATGAAGAGGGAGGATGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
954945953 3:54424604-54424626 GCTGAGCTGCAGATGGAGCCAGG + Intronic
955094346 3:55782344-55782366 GCTGAAATGCAAAAGGATGCAGG - Intronic
955148890 3:56347407-56347429 GCTGGGAGGCTGGAGGAGGAAGG + Intronic
955408317 3:58639781-58639803 GTTGGGATGGAGATGGAGGAGGG + Intronic
956008535 3:64805951-64805973 GGTCAGTTACAGAAGGAGGAAGG - Intergenic
956420494 3:69081738-69081760 CATGTGATGCAGAAGGAGGCTGG - Intergenic
956494994 3:69815402-69815424 GCTGAGGGGGAGAAGGAAGAGGG - Intronic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
956957842 3:74361405-74361427 ACTGAGATGAAGAAGCAGGATGG - Intronic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
958913435 3:100021359-100021381 GCTGAGATGCTGAACTTGGAAGG - Intronic
958915888 3:100049664-100049686 GCTGAGAAGGAGGAGGAAGAAGG - Intronic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
960845111 3:121997661-121997683 GCTGTGAGGCAGAAGGAGATGGG + Intronic
961041418 3:123681252-123681274 GCTGAGATCCAAAAAGAGGGAGG + Intronic
961371735 3:126435635-126435657 GCTGAGATCAAGAAGAAGGTAGG + Exonic
961379097 3:126485895-126485917 GGTGAGATGCAGGAGGGGCAGGG - Intronic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961938958 3:130617438-130617460 GCAGGCATGCAGAAAGAGGATGG + Intronic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
963130004 3:141849214-141849236 GCTGATAAGGAGAAGCAGGACGG + Intergenic
963928714 3:150979190-150979212 GGAGAGAAGCAGAAGGAGTAGGG + Intergenic
964885272 3:161474884-161474906 GCTGAGATGCAGTAGCATGCAGG + Intergenic
965179445 3:165383245-165383267 GATGAGATGGAAAAGGAGAAAGG + Intergenic
965749309 3:171959747-171959769 GCTGAGAGTCAGCAGGAGGGAGG + Intergenic
966504049 3:180679340-180679362 GCTGAGCTGCACTGGGAGGATGG - Exonic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
966932429 3:184684598-184684620 GCAGCCATTCAGAAGGAGGACGG + Intronic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967194968 3:187018120-187018142 GCTGAGATGGAGAGGCAGGCTGG + Intronic
967341681 3:188405597-188405619 GCTGAGATGCAGAAAAAGATAGG - Intronic
967386518 3:188916927-188916949 GCAGTAATGCTGAAGGAGGAAGG + Intergenic
967648605 3:191957467-191957489 GGAGGGATGGAGAAGGAGGAAGG + Intergenic
967848608 3:194064681-194064703 GAAGAGATGGAGAAAGAGGAAGG + Intergenic
967893770 3:194381761-194381783 GCAGAGATTCAGAAGGAGGGCGG + Intergenic
967954288 3:194865801-194865823 ACTGAGACTCAGAAGTAGGAAGG + Intergenic
968232912 3:197014997-197015019 GCTGAGATTCAGAAAGGGGAAGG + Intronic
968611870 4:1560904-1560926 GCCGAGAGGCAGCATGAGGAGGG + Intergenic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
968748276 4:2372387-2372409 GCTGAGGACTAGAAGGAGGATGG - Intronic
968985547 4:3872563-3872585 GCAGAGAGACAGAGGGAGGATGG + Intergenic
969285189 4:6198782-6198804 GCTGGGATGGGCAAGGAGGAGGG - Intronic
969477699 4:7430923-7430945 GCAGAGAGGCAGGAGGAGCAAGG - Intronic
969673093 4:8600541-8600563 GCTGTGATGAGGAAGCAGGAAGG + Intronic
970376498 4:15463010-15463032 ACTGTGATGCAGAGAGAGGATGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
972362687 4:38342998-38343020 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
973251950 4:48069750-48069772 ACTGAGACATAGAAGGAGGAAGG - Intronic
973646686 4:52957123-52957145 GCTGACATGCAGAAGGAGTGGGG + Intronic
975564942 4:75744344-75744366 ACTGAGATACGGAAGGATGATGG + Intronic
976481835 4:85555669-85555691 GCTGGGAGGCAGCAGGAGAAGGG + Intronic
976486913 4:85617331-85617353 GCTGAGTAACAGAAGTAGGAAGG - Intronic
976848986 4:89523515-89523537 ACTGAAATGCAGAAAGATGAAGG + Intergenic
978310738 4:107382535-107382557 GCTAAGACTGAGAAGGAGGAAGG + Intergenic
979557124 4:122061856-122061878 GCTGAGAAGGAGAAAGAAGAGGG - Intergenic
981421913 4:144560628-144560650 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
981564893 4:146089900-146089922 GCTGATTTAGAGAAGGAGGAAGG + Intergenic
982405553 4:155016003-155016025 GCAGAGATGCAGCAGGAAGATGG + Intergenic
983010177 4:162537335-162537357 CCAGAGATGGAGTAGGAGGAGGG + Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
985223390 4:187732042-187732064 GCTGAGGGGGAGGAGGAGGACGG - Intergenic
985747031 5:1653516-1653538 GCTCAGATGCAGAAACAGGCTGG - Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
986221994 5:5776354-5776376 CCTGGGATGCAGGAGGAGGGAGG + Intergenic
986266173 5:6193326-6193348 GCTGAGAGGCCGAAACAGGAGGG - Intergenic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
988785315 5:34561389-34561411 TCTTAGATCCAGAGGGAGGAAGG - Intergenic
990421813 5:55642981-55643003 ACTGAAATGCAAAAGAAGGAAGG - Intronic
990431170 5:55737074-55737096 GCTCTGATCCAGAAGGAGGGAGG - Intronic
990666358 5:58076988-58077010 GCTCTGATGCAAAAGTAGGAAGG + Intergenic
990869225 5:60413446-60413468 GATGAGAGGAGGAAGGAGGAAGG + Intronic
991085726 5:62646916-62646938 GCTGTGTGGCAGAGGGAGGAAGG - Intergenic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
991597467 5:68320328-68320350 GCTGGGGTGGAGAAGGAGGGAGG + Intergenic
991649989 5:68842804-68842826 GGTGGCATTCAGAAGGAGGATGG - Intergenic
992140254 5:73789381-73789403 GCTGGGGTGTGGAAGGAGGATGG + Intronic
992614880 5:78538071-78538093 GCTGAGATGCCGCAGGACTAGGG - Intronic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
993929730 5:93923074-93923096 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
995560603 5:113377074-113377096 GCTGAGACACAGCAGAAGGAAGG + Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
997442133 5:133916252-133916274 GCTGAGATGCATAGGGATGAGGG + Intergenic
997804598 5:136904851-136904873 GCTTAGCTGAAGCAGGAGGATGG - Intergenic
998215923 5:140238737-140238759 GCTCAGATGCAGAGGTAGGAAGG - Intronic
998816308 5:146017585-146017607 TCTGTGATACAGAAGGAGGGAGG - Intronic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
1000101780 5:158023612-158023634 GCTGAGATGAAGAATGAGCAGGG + Intergenic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000315105 5:160082786-160082808 GCTGTGATGCAGTAAGTGGAGGG + Intronic
1000687667 5:164272647-164272669 GCTGAGAGGCAGAAAGAGAAAGG + Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001225910 5:169944447-169944469 GGAGAGATGCTGAAGGAGGCAGG + Intronic
1001828486 5:174765894-174765916 GCTCAGATAGGGAAGGAGGATGG - Intergenic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1002956398 6:1869636-1869658 GCTGAGAAGCAGAAGTAAAATGG - Intronic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1003447176 6:6195276-6195298 GTTGAGTTGCCAAAGGAGGAAGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1004002805 6:11610891-11610913 GGTGAGGTGAGGAAGGAGGAGGG + Intergenic
1004420083 6:15461428-15461450 GCTGTAATCCAGGAGGAGGAGGG + Intronic
1005504615 6:26458677-26458699 GCTGAGGAGGAGGAGGAGGAGGG - Exonic
1005614600 6:27560527-27560549 GCTGAGATGCAGCTGGAAAAGGG - Intergenic
1005887628 6:30108794-30108816 TCTGTGCTGAAGAAGGAGGAAGG + Intronic
1006078140 6:31547551-31547573 GCAGAGACGCAGGTGGAGGACGG - Intronic
1006338261 6:33432044-33432066 GCTGAGGGGCAGAGGGAGGTGGG + Intronic
1008054404 6:46931388-46931410 GCTGTGATGCAGAAGTAGGGAGG - Intronic
1008585992 6:52949964-52949986 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1009898801 6:69785798-69785820 GCTGAGATCCAGAATAAGGCAGG - Intronic
1011566497 6:88679034-88679056 GCTGAGAAGGAGGAGGAAGAGGG - Intronic
1011956022 6:93026364-93026386 GCTGAGAAGAAGAAAGATGAGGG - Intergenic
1013442968 6:110190432-110190454 GCTGGGATGCAAAGAGAGGAGGG + Intronic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015450968 6:133365584-133365606 GTCAGGATGCAGAAGGAGGAAGG + Intronic
1017809063 6:157971018-157971040 GCTGAGATGAAGGAGGTAGAGGG + Intergenic
1018021770 6:159767794-159767816 GCTGAGGTTCAGGAGGAGGCAGG + Intronic
1018195867 6:161355930-161355952 ACTGAGATGGAAAGGGAGGAGGG + Intronic
1018376683 6:163219627-163219649 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018376691 6:163219662-163219684 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018376698 6:163219697-163219719 GCTGAGCTGTAGGAGGAGGCAGG - Intronic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1018656274 6:166040301-166040323 GCTGTGATGGAAAAGGTGGATGG - Intergenic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1018860141 6:167705318-167705340 GCCGAGCAGCAGTAGGAGGAGGG + Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019607902 7:1919198-1919220 GCTGAGATGCAGAGAGAAAAGGG + Intronic
1020011514 7:4808087-4808109 GAAGAGAGGAAGAAGGAGGAGGG - Intronic
1020517793 7:9145750-9145772 GGTGAAATGCAGAAGGATCAGGG - Intergenic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022289395 7:28986402-28986424 GATGAGATGCAGAAGGACCCTGG - Intergenic
1022469001 7:30670494-30670516 GGTGGGATGCAGAAGCGGGAGGG + Intronic
1023149127 7:37183190-37183212 GCACAGAAGGAGAAGGAGGAAGG + Intronic
1023639909 7:42247095-42247117 GTTTAGATGCAGGAGGAAGAAGG + Intergenic
1023714459 7:43029170-43029192 GCTGAGGTGGAGAATGAGGTGGG + Intergenic
1024127281 7:46312432-46312454 GCTGAGAAGGAAAAGGAAGAGGG + Intergenic
1024262141 7:47581235-47581257 GCTGACAAGCAGGAGGAGGGAGG - Intronic
1024353974 7:48395606-48395628 GCTGAGGAGGAGGAGGAGGAAGG - Intronic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1025142592 7:56478518-56478540 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1025155528 7:56602747-56602769 GCTGGGATGCAGGTGAAGGAAGG - Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025610806 7:63074056-63074078 GATGAGCTGCAGAAGGAGCAGGG - Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1025708653 7:63889119-63889141 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1026165741 7:67907701-67907723 GCGGAGATGCATAAGGGGAAAGG + Intergenic
1027050540 7:75018794-75018816 GGTGAGATGGAGAATCAGGACGG + Intronic
1027450244 7:78323298-78323320 GCTGAGATGCTGAAGGAATGAGG - Intronic
1027868692 7:83678780-83678802 GCTGAGATGCAGAAAGCAGTAGG + Intergenic
1028302119 7:89213192-89213214 ACAGAGATGCAGAAAGATGATGG + Intronic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1029869942 7:103680198-103680220 GGTGAGAAGGAGAGGGAGGAGGG + Intronic
1029971227 7:104791436-104791458 TCTGTGATGCAAAAGGAGAATGG - Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1030775616 7:113530643-113530665 GATCAGATGCAGCAGGAGCAAGG - Intergenic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1030977294 7:116142710-116142732 GCAGAGATGCAGACAGAGGAAGG + Intronic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032369949 7:131338897-131338919 GCTGAGAAGGAGAAAGAGAAGGG - Intronic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1032948716 7:136882440-136882462 GCTGAGAAGAAGGAGGGGGAAGG - Intronic
1033563987 7:142560981-142561003 GCTGGGAGGTAGAAGGAGAAGGG - Intergenic
1033712015 7:143957229-143957251 GCAGAGCAGGAGAAGGAGGAAGG + Intergenic
1033755535 7:144396161-144396183 GTTGAGATGTAGGAAGAGGAGGG - Intergenic
1035021270 7:155802397-155802419 GCTGAGAAGCAGGAGATGGAAGG + Exonic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037900101 8:22683168-22683190 GTTGAGATTCAGATGTAGGAGGG + Intergenic
1038547702 8:28438480-28438502 GCTGAGAGACAGGTGGAGGAGGG - Intronic
1038676944 8:29631464-29631486 GCTGAGAGGCCGAGGGAGGCAGG + Intergenic
1039022519 8:33223511-33223533 GCAGAGATCCAGATGGGGGAAGG + Intergenic
1039033487 8:33333868-33333890 GCTGAAATACAGAGTGAGGAAGG + Intergenic
1039206589 8:35162359-35162381 GCAGAGATGGAGAAAGAGCAGGG - Intergenic
1039410414 8:37350178-37350200 GCTGGGATGCAGAGAGAGGTGGG - Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1041321526 8:56618740-56618762 TCTGAGAGACAGAAGGAAGAAGG - Intergenic
1041766066 8:61419524-61419546 GCTGACATGCTGAAGGCTGATGG + Intronic
1041829073 8:62132424-62132446 GCTGAGCTGCAGTTAGAGGATGG + Intergenic
1043364579 8:79517798-79517820 GCTGAGAAGGAGAAGGCAGAGGG + Intergenic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1044288659 8:90441163-90441185 TCTGAGATGTAGAAGGAAAAAGG - Intergenic
1045291400 8:100835634-100835656 GGAGGGATGCTGAAGGAGGAAGG - Intergenic
1045397527 8:101775678-101775700 GCTCAGATCCAGATGGAGGTTGG + Intronic
1045519300 8:102889359-102889381 GCTTTGATGCAGTAGGAAGATGG - Intronic
1045948082 8:107819703-107819725 GCTAAGAGGCAGGAAGAGGAGGG - Intergenic
1046984314 8:120370485-120370507 GCAGGGATGCAGAAGAAGCAGGG - Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047508550 8:125498513-125498535 GCAGAGATTCATAAGAAGGAGGG - Intergenic
1048029265 8:130615699-130615721 GCTGAGAGGGAAAAGGGGGAGGG - Intergenic
1048878496 8:138855059-138855081 GCTGAGACTCAGAAGGATGCTGG - Intronic
1049031897 8:140044146-140044168 GCTGTGAAGCAGAAGAAAGAGGG - Intronic
1049194274 8:141307264-141307286 GCTGAGACGCAGAAGGTGCGGGG + Intronic
1049264673 8:141661084-141661106 GCTGAGATACCAAAGGAGGAGGG + Intergenic
1049699804 8:144005252-144005274 GATGAGCTGCTGAAGGTGGATGG + Intronic
1050241995 9:3646409-3646431 GCTCAGCAGCAGAAGCAGGAAGG - Intergenic
1050526204 9:6548984-6549006 GCTGAGATGTGGATGGAGGTCGG - Intronic
1051378740 9:16433057-16433079 GCTGAGCTGCAGGAAGAGGCAGG + Intronic
1051840457 9:21391951-21391973 GCTGCGAAGCAGGAGGAGGAAGG + Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053157781 9:35792259-35792281 GCTGGGATGCAGAAGGTGCTGGG - Exonic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053585792 9:39457261-39457283 GCGGAGATGTGGAAGAAGGAAGG - Intergenic
1054580515 9:66907961-66907983 GCGGAGATGTGGAAGAAGGAAGG + Intronic
1054814015 9:69457187-69457209 ACCCAGATGCAGAAGGAGTAAGG + Intronic
1054825388 9:69567829-69567851 GCAGAGATGCTCAAGGTGGAGGG - Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1055766066 9:79664741-79664763 GCTGAAGTCTAGAAGGAGGATGG - Intronic
1057045323 9:91881817-91881839 CCTGAGATGAAGAAGGATGAGGG + Intronic
1057219224 9:93247085-93247107 CCCGAGTTGCAGATGGAGGAAGG - Intronic
1057396046 9:94681449-94681471 GATGAGAAGGAGGAGGAGGATGG - Intergenic
1057925017 9:99138670-99138692 GGTCAGATGCTGAAGAAGGAAGG + Intronic
1058067581 9:100566429-100566451 ACTGAGATGAAGAAGGTGGCAGG - Intronic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059350461 9:113660643-113660665 GATGAGATGGAAAAGGAGGTAGG + Intergenic
1060046031 9:120341819-120341841 GCTCAGAAGAAGGAGGAGGAGGG + Intergenic
1060186729 9:121568236-121568258 GCTGAGCTCCTGCAGGAGGAAGG - Intronic
1060452395 9:123755493-123755515 GCTGAGGTGGAAGAGGAGGAAGG - Intronic
1060539853 9:124421960-124421982 GCTGAGACTCAGAAGGACCAGGG + Intergenic
1061489861 9:130938914-130938936 GCGGAGATTGAGAAGGAGGGAGG - Intronic
1062023924 9:134331859-134331881 GCTGAGAGGCAGGAGGACCAGGG - Intronic
1062207073 9:135343103-135343125 GCTGAGAGGCAGGAGGAAGCTGG - Intergenic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1062375460 9:136259952-136259974 GCTGAGATGCAGAAACAGGGAGG + Intergenic
1185550610 X:980616-980638 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185550642 X:980720-980742 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185550843 X:981353-981375 GCTGGGATGGAGGAGGAAGAGGG + Intergenic
1185764555 X:2715111-2715133 GAAGAGCTGCAGAAGAAGGAAGG - Intronic
1186049700 X:5577761-5577783 GCTGAGATGGAAGAAGAGGAGGG - Intergenic
1186376122 X:9003497-9003519 GCAGAGAAGCAGAAGGAGACAGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188993322 X:36851370-36851392 ACTGAGATGCAGAAGAATAAAGG - Intergenic
1189919039 X:45885417-45885439 CATGAGATGAAGAAGGAGTATGG + Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190948725 X:55121192-55121214 GCTCAGACACAGAAGGAGGTGGG - Intronic
1194703687 X:97148132-97148154 ACTGAGATGCAGAATGATAAAGG + Intronic
1194984115 X:100471640-100471662 GATGAGATACAGAAATAGGAAGG + Intergenic
1195431276 X:104792137-104792159 ACTGAGGTTCAGAAAGAGGAAGG + Intronic
1195677108 X:107514970-107514992 GCTGAGATGAGGAAGGCTGAGGG + Intergenic
1195705564 X:107735698-107735720 GCTGAGGGGAAGAAGGAGAAGGG - Intronic
1196025048 X:111033315-111033337 GTAGAGATGGAGGAGGAGGAGGG - Intronic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1197228259 X:123975386-123975408 GCAGAGAAGCAGAAGCATGAAGG + Intronic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1198728274 X:139700254-139700276 GCTTGGATGGAAAAGGAGGAAGG - Intronic
1199982821 X:152930166-152930188 GCTATGGTGCAGAAGGTGGAAGG - Intronic
1201857715 Y:18563909-18563931 GCAGAGGTGCAGAGGAAGGAGGG + Intronic
1201875606 Y:18756472-18756494 GCAGAGGTGCAGAGGAAGGAGGG - Intronic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic