ID: 1090131557

View in Genome Browser
Species Human (GRCh38)
Location 11:124147411-124147433
Sequence CTTTTCACTCAGAAAGTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090131552_1090131557 8 Left 1090131552 11:124147380-124147402 CCACTCAGAATTCCTAGAGGAAC 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1090131557 11:124147411-124147433 CTTTTCACTCAGAAAGTGGGTGG 0: 1
1: 1
2: 0
3: 20
4: 184
1090131554_1090131557 -4 Left 1090131554 11:124147392-124147414 CCTAGAGGAACATCGGTGACTTT 0: 1
1: 0
2: 0
3: 14
4: 76
Right 1090131557 11:124147411-124147433 CTTTTCACTCAGAAAGTGGGTGG 0: 1
1: 1
2: 0
3: 20
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090131557 Original CRISPR CTTTTCACTCAGAAAGTGGG TGG Exonic
901897386 1:12326068-12326090 CTTTTCACACATAAATTGGCTGG - Intronic
902057449 1:13613677-13613699 CTATTCACAGAGAAAGTGGATGG + Exonic
904050772 1:27636939-27636961 CTTTTCTCTTAGGAAATGGGAGG + Intergenic
904560320 1:31392700-31392722 CTTTTCACACAGAAAGGTGGAGG - Intergenic
906095937 1:43223968-43223990 CCTTACACTGAGACAGTGGGAGG + Intronic
906846881 1:49202352-49202374 TTTTTCACTCAGGAAGTGTGAGG - Intronic
906919869 1:50052334-50052356 CTTTACACACAAAAAGTGTGGGG - Intronic
907845120 1:58198363-58198385 TTTTTCATTCAAAAAGTGGCTGG + Intronic
908137077 1:61144229-61144251 CTTCTCACTGAGTAAGTCGGGGG - Intronic
911480298 1:98430356-98430378 CTCTTCACACAGAGAGTGGGTGG + Intergenic
915100399 1:153495141-153495163 CTCTTAATTTAGAAAGTGGGTGG - Intergenic
916121550 1:161532847-161532869 TTTTTATCTCAGAAAGTCGGAGG - Intergenic
916489704 1:165290825-165290847 CTTCTGACTCAGAAGGTGGGTGG - Intronic
916725448 1:167518471-167518493 CCTTTCCCTCAGAAAGAGGCTGG + Exonic
917224028 1:172762714-172762736 CTATGTCCTCAGAAAGTGGGAGG + Intergenic
917292261 1:173482897-173482919 TTTTTCACTCAGAGAGTTGGAGG + Intronic
919016604 1:192045910-192045932 TTTTTGACTGAGAAAATGGGTGG + Intergenic
919691980 1:200535856-200535878 CTTTCCAATCAGCAAGTGCGAGG - Intergenic
920134643 1:203759671-203759693 CTTTCCAATAACAAAGTGGGTGG + Intergenic
920542811 1:206792207-206792229 ATGTTCACTCAGGAAGTGGGTGG - Intergenic
921759958 1:218901842-218901864 CTTTTCACTCAGAAAGTGTGAGG - Intergenic
921829427 1:219710631-219710653 CATTTCCCTAAGAAAGTTGGGGG - Intronic
923389575 1:233500727-233500749 CTTTTCTCTTAGAAAGTATGTGG + Intergenic
924376417 1:243414009-243414031 CTTGGCACACAGGAAGTGGGTGG - Intronic
1063356091 10:5399731-5399753 CTGTTGACTGAGAGAGTGGGAGG - Intronic
1064000689 10:11661590-11661612 CTTGTCAATCAGAATGAGGGAGG - Intergenic
1067549535 10:47224564-47224586 CTTTTTACTGAAAAAGTTGGTGG + Intergenic
1070837305 10:79457528-79457550 CTTCTCACTAACAAAGTGGTAGG - Intergenic
1071056772 10:81520489-81520511 CTTTCCACTCAGACTATGGGAGG - Intergenic
1071069717 10:81677569-81677591 CTTTAAACTCAAGAAGTGGGAGG - Intergenic
1071103892 10:82071644-82071666 CTTTTTACTCAGAAAGGGATGGG + Intronic
1071373923 10:84983101-84983123 CTTTCCATTCAGAAAATGAGGGG - Intergenic
1074056705 10:109928807-109928829 CTTTTCCCTCATAGGGTGGGAGG - Intergenic
1074417564 10:113280614-113280636 ATTTTCAACCAGAAAGTGTGTGG + Intergenic
1075034051 10:119047910-119047932 CTTTTCACTCAGAAAGCTCAAGG - Intronic
1075091696 10:119447395-119447417 CGTTTGACTTAGAAAGCGGGAGG - Intronic
1076350010 10:129809233-129809255 CTTTCCTCTCAGAAAGTGTATGG + Intergenic
1076420769 10:130330144-130330166 TTTTTCTCTCAGACAGTGCGGGG + Intergenic
1082305355 11:50566074-50566096 CTTTTCACTCAGCAATTTGTTGG - Intergenic
1084252918 11:67915713-67915735 CTTTTAAATCAGGAAGTGTGAGG - Intergenic
1086867807 11:92001428-92001450 CATTTGACTCAGAAAGTGGCAGG + Intergenic
1088266860 11:107996205-107996227 CTTATCACACAGAAAGGGTGTGG + Intergenic
1088705925 11:112464741-112464763 CTTTGGACTCAGAAACTGGTGGG - Intergenic
1088737806 11:112742648-112742670 CTTGTCACACAGAAAGCTGGAGG - Intergenic
1090131557 11:124147411-124147433 CTTTTCACTCAGAAAGTGGGTGG + Exonic
1090855899 11:130609164-130609186 CCTCCCACTGAGAAAGTGGGTGG + Intergenic
1093276903 12:17140228-17140250 GTTTTCACACAGAAAGTTGAAGG + Intergenic
1094395086 12:29996859-29996881 CTTTGCACTCTGGAAGTGGAGGG + Intergenic
1097288024 12:57892580-57892602 CTTGGCACCCAGAAGGTGGGGGG + Intergenic
1097915617 12:65017901-65017923 CTTTACCCTCAGAAAGAGGCAGG - Intergenic
1099433583 12:82618167-82618189 CTTTTCATTTACAAAGTTGGGGG - Intergenic
1102228191 12:111244252-111244274 CTTTCCACCCAGGAAGTGTGTGG + Intronic
1104415219 12:128592391-128592413 CTTGCCATTCAGAAACTGGGAGG - Intronic
1105699436 13:22925394-22925416 TTTTTCACTCATAAAATTGGGGG + Intergenic
1106063033 13:26313809-26313831 CCTTTAACTCAGAAAGGAGGTGG + Intronic
1106457073 13:29936814-29936836 AGTTCCACTCAGAAAGTGAGAGG - Intergenic
1107087880 13:36445588-36445610 CTATTCCCTCTGAAACTGGGCGG - Intergenic
1107103716 13:36621860-36621882 CTTTTGATCCAGAAAGAGGGAGG - Intergenic
1108224753 13:48276984-48277006 CTTTTCAATCAGTAAATGGCAGG - Intergenic
1109554796 13:63958666-63958688 TTTTTCATCCAGAAAGTGGGAGG + Intergenic
1109678621 13:65716013-65716035 CTCTTCACTTGTAAAGTGGGTGG + Intergenic
1110189745 13:72716728-72716750 CTTTTAAATCAGAAAGTCTGTGG + Intronic
1111389193 13:87569340-87569362 CTTTTCACTGAAAAAGAGAGGGG + Intergenic
1115925555 14:38429451-38429473 CTTTACACCCTGAAAGTGGGAGG - Intergenic
1117023222 14:51593939-51593961 CTTTTGCTTCAGAAAGTAGGGGG - Intronic
1119688378 14:76651474-76651496 CTTTCCACTCAGCATTTGGGAGG + Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122235944 14:100330693-100330715 GCTTTCGCTCAGAAAGCGGGTGG - Intergenic
1124499267 15:30212338-30212360 CCTCCCACTCAGGAAGTGGGTGG + Intergenic
1126667866 15:51091282-51091304 CTCTGCACGCACAAAGTGGGGGG + Intronic
1127026136 15:54808700-54808722 CTTTCCACTCAGCCAGTGGGTGG - Intergenic
1131008442 15:88997588-88997610 GTTTTTACACAGAAAGGGGGTGG - Intergenic
1134874368 16:17683894-17683916 CTTCCCACTCAGAGAGTGAGAGG + Intergenic
1139427354 16:66890833-66890855 CTTTCCACTCAGATAGTGCCAGG - Exonic
1140367829 16:74395397-74395419 CTTCTCACACAGGAAGTAGGAGG + Intergenic
1140450748 16:75068973-75068995 CTCTTCATTCAGAAAATGGATGG + Intronic
1143542143 17:7575439-7575461 CATTTGACTCAGGAAATGGGTGG - Intronic
1145212662 17:21026432-21026454 CTACTCACTCAGGAGGTGGGAGG - Intronic
1146671331 17:34740176-34740198 CTTTTTACCCTGAAAGTGGGTGG + Intergenic
1151046642 17:70928062-70928084 CTTTTCACTCTGAAAATATGTGG + Intergenic
1151375929 17:73689136-73689158 CTTTTTATTCACAAAGAGGGAGG - Intergenic
1152493117 17:80651198-80651220 CTTCTAAGTCAGAAAGTGGAAGG + Intronic
1153179928 18:2421493-2421515 GTCTTCTTTCAGAAAGTGGGAGG - Intergenic
1154162099 18:11988418-11988440 CTTTTTACTCTGAATGTGAGGGG + Intronic
1154529927 18:15332618-15332640 TTTCTCACTATGAAAGTGGGAGG - Intergenic
1157114683 18:44851916-44851938 GTTGGCACTCAGAAAGAGGGTGG - Intronic
1157695972 18:49723978-49724000 CTGTTGACTGAGAATGTGGGAGG - Intergenic
1162846550 19:13397179-13397201 CTTTGACCTCAGAAACTGGGGGG - Intronic
1164793937 19:31011290-31011312 TTCTTCACTCTGAAAGTGGGAGG - Intergenic
1164809995 19:31148093-31148115 CATTTCACTCAGTGGGTGGGTGG + Intergenic
926295941 2:11568648-11568670 CTTTACAGTCACAAAGTGGTGGG - Intronic
928064024 2:28145035-28145057 CTTTAGATTCAGAATGTGGGTGG - Intronic
929365877 2:41156195-41156217 GTTTTCATCCAGAAAGTGTGTGG + Intergenic
930272276 2:49270736-49270758 TTTTTCTCTCAGAAATTGGTTGG + Intergenic
930809946 2:55529986-55530008 CTATTAAATCAGAAACTGGGAGG - Intronic
930874690 2:56201886-56201908 CATTTCATTCAGAACATGGGCGG - Intronic
931304213 2:61012923-61012945 GTTTTTACTCAGAAAGGTGGAGG - Intronic
934101677 2:88659390-88659412 CGTCTCACTCAGAATGTGGTTGG - Intergenic
934103929 2:88679145-88679167 TTTTTCACACAGAAAGGTGGGGG + Intergenic
935074398 2:99726750-99726772 CTTTTCACACTTAAACTGGGAGG - Intronic
938639172 2:133262549-133262571 CCTTTCTCTCAGAGAGTAGGTGG - Intronic
938745382 2:134273115-134273137 CATTTCCCCCAGAAGGTGGGGGG + Intronic
939687919 2:145222840-145222862 ATTGGCACTCAGAAGGTGGGTGG - Intergenic
940550176 2:155144208-155144230 CTTTTTACACAGAAAGATGGAGG + Intergenic
942077370 2:172368157-172368179 CTTTTCACTCAGATACTCAGAGG - Intergenic
944184317 2:196930086-196930108 CTGTTCACTCAGAAAGGAGTGGG + Intergenic
945359620 2:208881131-208881153 CTTTTCTGTCAGAAATAGGGTGG - Intergenic
945590983 2:211731170-211731192 CTTTTCACTCAGACAGCTGCTGG - Intronic
946230334 2:218287311-218287333 TCTATCACTCAGAGAGTGGGCGG - Intronic
1169692426 20:8346702-8346724 CTTTTCACTCAAAAAGTCAATGG - Intronic
1171112802 20:22499983-22500005 GTCCTCACTTAGAAAGTGGGTGG + Intergenic
1178461910 21:32810135-32810157 CTATTCACTCAAAAAGAAGGGGG - Intronic
1178600546 21:33990813-33990835 GTTTTCCCTCAGAAAGGAGGAGG + Intergenic
1183655405 22:39181606-39181628 CTTTTCACTGAGAAAGCAGAAGG - Intergenic
951557893 3:23938990-23939012 CTTGGCAATCAGACAGTGGGTGG - Intronic
952245421 3:31584643-31584665 ATTCTCACCCAGAAACTGGGAGG + Intronic
952553799 3:34508796-34508818 ATTTGAACTCAGAAAGAGGGTGG + Intergenic
952643567 3:35627766-35627788 AGTTTCACTGAGAAAGTGAGAGG - Intergenic
953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG + Intronic
957348642 3:78994840-78994862 CTTTTCACTGAGACAGTGAAGGG - Intronic
960795530 3:121482595-121482617 CTTTCCCCTCAGAATGGGGGGGG + Intronic
961539669 3:127590951-127590973 TTTCTCACTCGGAAAGCGGGCGG + Intronic
962731143 3:138284771-138284793 GTCTTCACTCAGTAAGAGGGAGG - Intronic
963669499 3:148233791-148233813 CTTTTTAGTCAGAAAGAGGGAGG + Intergenic
964438860 3:156683174-156683196 CTTTTAAATCAGACAGTTGGAGG + Intronic
964506983 3:157410309-157410331 CTTTCCACATAGAAAGTGGTGGG + Intronic
967057693 3:185844070-185844092 CTTGTCACTCAGTAGGTGGCAGG + Intergenic
967328336 3:188265039-188265061 GCTTTGAGTCAGAAAGTGGGTGG - Intronic
968171959 3:196517931-196517953 CTTTTCTAACAGAAAGTGGCTGG + Intergenic
971333601 4:25702572-25702594 CTTTTCATTCCCAAAGTGGGAGG + Intergenic
972372528 4:38438465-38438487 CACTTCACTCAGAAAGTGCAAGG - Intergenic
974115735 4:57577015-57577037 TTTTCCTCTCAGAAAGTGTGTGG + Intergenic
976744669 4:88391317-88391339 CTTTTAACTGAGGAAGAGGGAGG - Intronic
977296841 4:95219384-95219406 CTTTCGGCTCAGAAAGTGTGAGG - Intronic
977314557 4:95429522-95429544 CATTTAACTTTGAAAGTGGGAGG - Intronic
978712722 4:111804769-111804791 CTTTCCTCTCTGAAAATGGGTGG - Intergenic
979100245 4:116603836-116603858 CTTTTCATTTCTAAAGTGGGAGG + Intergenic
980342824 4:131572557-131572579 CTTTACATTAAGAAAATGGGTGG + Intergenic
981863420 4:149384347-149384369 ATTTTTAGTTAGAAAGTGGGAGG - Intergenic
983636449 4:169902416-169902438 CTCCTCAGTCAGAAAATGGGAGG - Intergenic
983711281 4:170719929-170719951 CTTCCAAATCAGAAAGTGGGAGG + Intergenic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
990331420 5:54729837-54729859 ATTTTCACTCAGTAAGAGGTAGG - Intergenic
993006729 5:82436526-82436548 CTTCTCTCTCAGATGGTGGGGGG - Intergenic
996106851 5:119515335-119515357 TTCTTCACTCTTAAAGTGGGCGG - Intronic
996164344 5:120206618-120206640 ACTTTCACCCAGAAAGTGGCAGG - Intergenic
996284478 5:121772026-121772048 CTTTTCTCTAAGAAAGCTGGGGG - Intergenic
997619659 5:135277880-135277902 CTTTTCTCTCAGAACATTGGTGG + Intronic
998786149 5:145711203-145711225 ATTTTCACTTAGAAAGTAGGAGG + Intronic
1001047039 5:168381858-168381880 AATTTCACTGAGAATGTGGGGGG + Intronic
1001257819 5:170198103-170198125 CTTTTCTCTCAGAGATTTGGGGG + Intergenic
1002812181 6:641157-641179 CTTTTCTCTCACATAATGGGAGG + Intronic
1003494521 6:6652545-6652567 ATTTTCATTCAGAAAGCAGGAGG - Intronic
1004505996 6:16247094-16247116 CCCTTCAATCAGAAAGTGGACGG + Intronic
1004853019 6:19719819-19719841 CTTTGCACGCTGAAAGGGGGAGG - Intergenic
1005387271 6:25297943-25297965 CTATTAACACAGAAAATGGGAGG - Intronic
1005477828 6:26225610-26225632 CTTTTCACGGACAAAGTGGTTGG - Intergenic
1007122155 6:39391348-39391370 CCTTTCACTCACAGATTGGGTGG - Intronic
1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG + Intergenic
1007599834 6:43074963-43074985 CTTTTCAGTCAGAGGGTTGGGGG + Exonic
1010899020 6:81402960-81402982 CTTATCACTCAGTATCTGGGAGG - Intergenic
1011261192 6:85471356-85471378 CTCATCGCTCAGAAAGTGAGGGG + Exonic
1014233566 6:118930836-118930858 CTTTTAAAACAGAAAGTGAGGGG + Intronic
1014799433 6:125761306-125761328 CTTTCCACATAGAAAGTGGAAGG - Intergenic
1016020044 6:139227891-139227913 CTTTTCTCTAAGAAGGAGGGAGG + Intergenic
1016753534 6:147658674-147658696 CTTTCAAGTCAGAACGTGGGTGG + Intronic
1022872072 7:34490144-34490166 CTTTTGCCTAAGAATGTGGGGGG + Intergenic
1026475163 7:70728947-70728969 CTGTTCACTGAGTAACTGGGAGG - Intronic
1029859065 7:103549720-103549742 GACTTCACTCAGAAAGTGTGGGG - Intronic
1029925835 7:104315864-104315886 TTTTGCAATCAGAAAGTGTGAGG - Intergenic
1030295042 7:107916182-107916204 CTTGTCACACAGCTAGTGGGTGG + Intronic
1031130595 7:117829084-117829106 ACTTTCAGTGAGAAAGTGGGTGG - Intronic
1031497560 7:122469510-122469532 CTCTGCACTTAGAAAATGGGGGG - Intronic
1032322059 7:130894620-130894642 CTTTTCCCTTTGAGAGTGGGAGG - Intergenic
1032810656 7:135412730-135412752 CTTCTCATTTAGAAGGTGGGGGG - Intronic
1034385307 7:150736198-150736220 ATTTTCACACAGAGACTGGGAGG - Intronic
1034848665 7:154472465-154472487 CTATTAAATAAGAAAGTGGGAGG - Intronic
1035085849 7:156257248-156257270 CTTTTCGCCCAGAGAGTAGGTGG - Intergenic
1035276403 7:157750542-157750564 CTGTTCACTCAGATATTGGCAGG - Intronic
1035666086 8:1380521-1380543 CTTTTTTCTGAGAAAGTGTGCGG + Intergenic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1037234415 8:16701032-16701054 CTTTTTACTTAGAGAGTGGCTGG - Intergenic
1037371341 8:18182764-18182786 ATTTTCACTCAAAAAGTGTTGGG + Intronic
1038202893 8:25431552-25431574 CTTTGCAATCAGAGAGAGGGAGG + Intronic
1039299609 8:36195197-36195219 CTTTTCTTTCAGAAGTTGGGTGG + Intergenic
1040049390 8:42997187-42997209 CTCTGCACTCAGGAAGTGGGTGG - Intronic
1041291954 8:56316497-56316519 CTCTGTATTCAGAAAGTGGGAGG + Intronic
1045380993 8:101625704-101625726 CTTGCCAATCAGAAAGTAGGTGG + Intronic
1046081864 8:109379182-109379204 CTTGTCACTGAGAAGCTGGGTGG - Intronic
1046375589 8:113376451-113376473 CATTTCATTCAAAAACTGGGAGG + Intronic
1046688326 8:117252828-117252850 CTTTTCAGACAGAAAGGGAGAGG - Intergenic
1047626788 8:126664885-126664907 ATTCTCCCTTAGAAAGTGGGAGG - Intergenic
1048581472 8:135732671-135732693 CTTTCCACTGGGAAAGTGAGAGG + Intergenic
1052772803 9:32704974-32704996 CTTTTTCCCCAGAAAGTGGTTGG + Intergenic
1054736470 9:68755949-68755971 CTTTTCTTTCAGCAACTGGGTGG + Intronic
1055169623 9:73239990-73240012 CTCTTCTCTCAGAAGATGGGTGG + Intergenic
1057404928 9:94760805-94760827 CTCTTAACTCAGAAATAGGGAGG - Intronic
1057990132 9:99760307-99760329 CTTTTCATTCAGAAAGAAGGAGG + Intergenic
1060677487 9:125528542-125528564 CTTTTCAGTTAGAAAATGGAAGG + Intronic
1186144177 X:6608673-6608695 CTTTGCACTCACCAAGAGGGAGG - Intergenic
1186271610 X:7895099-7895121 CTTAACACTCAGAAACTGAGAGG - Intergenic
1187471147 X:19570649-19570671 TTTTTCACTCAAAGAATGGGTGG + Intronic
1188060139 X:25590841-25590863 CTTATGTCTCAGAAAGTGTGTGG + Intergenic
1188300378 X:28500789-28500811 CTTTTCACTCAGAAAATGTATGG - Intergenic
1196221621 X:113117837-113117859 GTTTTTACACAGAAAGTTGGAGG + Intergenic
1199472281 X:148208541-148208563 GTTTGCACTGAGAAACTGGGTGG + Intergenic