ID: 1090133252

View in Genome Browser
Species Human (GRCh38)
Location 11:124168143-124168165
Sequence TGCTTACGTGCTTTCTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090133252_1090133258 22 Left 1090133252 11:124168143-124168165 CCCTAGTAGAAAGCACGTAAGCA No data
Right 1090133258 11:124168188-124168210 TCTTAGATCACAGAGTAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090133252 Original CRISPR TGCTTACGTGCTTTCTACTA GGG (reversed) Intergenic
No off target data available for this crispr