ID: 1090135341

View in Genome Browser
Species Human (GRCh38)
Location 11:124192219-124192241
Sequence CAATTTTGACAGAGTGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090135341_1090135345 14 Left 1090135341 11:124192219-124192241 CCCAGTCCACTCTGTCAAAATTG No data
Right 1090135345 11:124192256-124192278 CTCCAAATAAATAAACACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090135341 Original CRISPR CAATTTTGACAGAGTGGACT GGG (reversed) Intergenic
No off target data available for this crispr