ID: 1090137057

View in Genome Browser
Species Human (GRCh38)
Location 11:124209812-124209834
Sequence GCTCCTGGGCAGAAGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090137057_1090137067 6 Left 1090137057 11:124209812-124209834 CCCGCCACCTTCTGCCCAGGAGC No data
Right 1090137067 11:124209841-124209863 GAGCATGTGCACCCCCGGCTGGG No data
1090137057_1090137072 22 Left 1090137057 11:124209812-124209834 CCCGCCACCTTCTGCCCAGGAGC No data
Right 1090137072 11:124209857-124209879 GGCTGGGCTACAACAATGCCCGG No data
1090137057_1090137074 28 Left 1090137057 11:124209812-124209834 CCCGCCACCTTCTGCCCAGGAGC No data
Right 1090137074 11:124209863-124209885 GCTACAACAATGCCCGGGCTTGG No data
1090137057_1090137066 5 Left 1090137057 11:124209812-124209834 CCCGCCACCTTCTGCCCAGGAGC No data
Right 1090137066 11:124209840-124209862 TGAGCATGTGCACCCCCGGCTGG No data
1090137057_1090137064 1 Left 1090137057 11:124209812-124209834 CCCGCCACCTTCTGCCCAGGAGC No data
Right 1090137064 11:124209836-124209858 TGCCTGAGCATGTGCACCCCCGG No data
1090137057_1090137073 23 Left 1090137057 11:124209812-124209834 CCCGCCACCTTCTGCCCAGGAGC No data
Right 1090137073 11:124209858-124209880 GCTGGGCTACAACAATGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090137057 Original CRISPR GCTCCTGGGCAGAAGGTGGC GGG (reversed) Intergenic
No off target data available for this crispr