ID: 1090138718

View in Genome Browser
Species Human (GRCh38)
Location 11:124229182-124229204
Sequence ATAGGGAGTCCGTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090138718_1090138723 13 Left 1090138718 11:124229182-124229204 CCTGTTACTTACGGACTCCCTAT No data
Right 1090138723 11:124229218-124229240 TTCGTGTTATGGACTTGTTATGG No data
1090138718_1090138724 24 Left 1090138718 11:124229182-124229204 CCTGTTACTTACGGACTCCCTAT No data
Right 1090138724 11:124229229-124229251 GACTTGTTATGGCTTTTATGTGG No data
1090138718_1090138722 2 Left 1090138718 11:124229182-124229204 CCTGTTACTTACGGACTCCCTAT No data
Right 1090138722 11:124229207-124229229 TTTACGGAGTCTTCGTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090138718 Original CRISPR ATAGGGAGTCCGTAAGTAAC AGG (reversed) Intergenic