ID: 1090148603

View in Genome Browser
Species Human (GRCh38)
Location 11:124357275-124357297
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090148601_1090148603 14 Left 1090148601 11:124357238-124357260 CCTAATTTTACTTTACTTGATCA No data
Right 1090148603 11:124357275-124357297 CATCTTTTCTAGAAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090148603 Original CRISPR CATCTTTTCTAGAAGAAAAA AGG Intergenic
No off target data available for this crispr