ID: 1090148603 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:124357275-124357297 |
| Sequence | CATCTTTTCTAGAAGAAAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1090148601_1090148603 | 14 | Left | 1090148601 | 11:124357238-124357260 | CCTAATTTTACTTTACTTGATCA | No data | ||
| Right | 1090148603 | 11:124357275-124357297 | CATCTTTTCTAGAAGAAAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1090148603 | Original CRISPR | CATCTTTTCTAGAAGAAAAA AGG | Intergenic | ||
| No off target data available for this crispr | |||||