ID: 1090160022

View in Genome Browser
Species Human (GRCh38)
Location 11:124482744-124482766
Sequence GTGGAGAAGCAGAAGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090160022_1090160028 10 Left 1090160022 11:124482744-124482766 CCCCTCTGCTTCTGCTTCTCCAC No data
Right 1090160028 11:124482777-124482799 CTTATTCTCTTTGAGAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090160022 Original CRISPR GTGGAGAAGCAGAAGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr