ID: 1090161231

View in Genome Browser
Species Human (GRCh38)
Location 11:124497811-124497833
Sequence TACCCCATCCCCCTTGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090161231_1090161238 14 Left 1090161231 11:124497811-124497833 CCCCTACCAAGGGGGATGGGGTA No data
Right 1090161238 11:124497848-124497870 CAAATGCTGGTCCAGAGGACAGG No data
1090161231_1090161236 1 Left 1090161231 11:124497811-124497833 CCCCTACCAAGGGGGATGGGGTA No data
Right 1090161236 11:124497835-124497857 ATCAAAGAGGCTACAAATGCTGG No data
1090161231_1090161237 9 Left 1090161231 11:124497811-124497833 CCCCTACCAAGGGGGATGGGGTA No data
Right 1090161237 11:124497843-124497865 GGCTACAAATGCTGGTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090161231 Original CRISPR TACCCCATCCCCCTTGGTAG GGG (reversed) Intergenic
No off target data available for this crispr