ID: 1090161521

View in Genome Browser
Species Human (GRCh38)
Location 11:124500249-124500271
Sequence ATTTCAGGCAAATCTAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090161521_1090161526 18 Left 1090161521 11:124500249-124500271 CCTCCACTAGATTTGCCTGAAAT No data
Right 1090161526 11:124500290-124500312 TTAATTTGAATCTTCATCTTAGG No data
1090161521_1090161527 19 Left 1090161521 11:124500249-124500271 CCTCCACTAGATTTGCCTGAAAT No data
Right 1090161527 11:124500291-124500313 TAATTTGAATCTTCATCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090161521 Original CRISPR ATTTCAGGCAAATCTAGTGG AGG (reversed) Intergenic
No off target data available for this crispr