ID: 1090162376

View in Genome Browser
Species Human (GRCh38)
Location 11:124509594-124509616
Sequence GCCCAGTTCAGACCGCTTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090162373_1090162376 30 Left 1090162373 11:124509541-124509563 CCTTCATTCCTATCCATATTCTG 0: 5
1: 9
2: 18
3: 24
4: 305
Right 1090162376 11:124509594-124509616 GCCCAGTTCAGACCGCTTGCCGG No data
1090162374_1090162376 22 Left 1090162374 11:124509549-124509571 CCTATCCATATTCTGAATTCTAT 0: 120
1: 240
2: 257
3: 192
4: 421
Right 1090162376 11:124509594-124509616 GCCCAGTTCAGACCGCTTGCCGG No data
1090162375_1090162376 17 Left 1090162375 11:124509554-124509576 CCATATTCTGAATTCTATTTCTG 0: 154
1: 288
2: 360
3: 436
4: 1234
Right 1090162376 11:124509594-124509616 GCCCAGTTCAGACCGCTTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090162376 Original CRISPR GCCCAGTTCAGACCGCTTGC CGG Intergenic
No off target data available for this crispr