ID: 1090172931

View in Genome Browser
Species Human (GRCh38)
Location 11:124620683-124620705
Sequence CTATTCAGTGATTAGCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090172931_1090172933 -5 Left 1090172931 11:124620683-124620705 CCTTACAGCTAATCACTGAATAG No data
Right 1090172933 11:124620701-124620723 AATAGCAAGCACTTACAAATGGG No data
1090172931_1090172932 -6 Left 1090172931 11:124620683-124620705 CCTTACAGCTAATCACTGAATAG No data
Right 1090172932 11:124620700-124620722 GAATAGCAAGCACTTACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090172931 Original CRISPR CTATTCAGTGATTAGCTGTA AGG (reversed) Intergenic
No off target data available for this crispr