ID: 1090172933

View in Genome Browser
Species Human (GRCh38)
Location 11:124620701-124620723
Sequence AATAGCAAGCACTTACAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090172928_1090172933 15 Left 1090172928 11:124620663-124620685 CCAGAGGATACTATGCCTTCCCT No data
Right 1090172933 11:124620701-124620723 AATAGCAAGCACTTACAAATGGG No data
1090172931_1090172933 -5 Left 1090172931 11:124620683-124620705 CCTTACAGCTAATCACTGAATAG No data
Right 1090172933 11:124620701-124620723 AATAGCAAGCACTTACAAATGGG No data
1090172929_1090172933 0 Left 1090172929 11:124620678-124620700 CCTTCCCTTACAGCTAATCACTG No data
Right 1090172933 11:124620701-124620723 AATAGCAAGCACTTACAAATGGG No data
1090172930_1090172933 -4 Left 1090172930 11:124620682-124620704 CCCTTACAGCTAATCACTGAATA No data
Right 1090172933 11:124620701-124620723 AATAGCAAGCACTTACAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090172933 Original CRISPR AATAGCAAGCACTTACAAAT GGG Intergenic
No off target data available for this crispr