ID: 1090173512

View in Genome Browser
Species Human (GRCh38)
Location 11:124626162-124626184
Sequence TTCCATTTAGTCTTTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 249}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090173508_1090173512 -2 Left 1090173508 11:124626141-124626163 CCCCCAACTCTCTGGGTTGCATT 0: 1
1: 0
2: 1
3: 27
4: 302
Right 1090173512 11:124626162-124626184 TTCCATTTAGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 249
1090173511_1090173512 -5 Left 1090173511 11:124626144-124626166 CCAACTCTCTGGGTTGCATTCCA 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1090173512 11:124626162-124626184 TTCCATTTAGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 249
1090173510_1090173512 -4 Left 1090173510 11:124626143-124626165 CCCAACTCTCTGGGTTGCATTCC 0: 1
1: 0
2: 2
3: 27
4: 639
Right 1090173512 11:124626162-124626184 TTCCATTTAGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 249
1090173503_1090173512 5 Left 1090173503 11:124626134-124626156 CCCCCTTCCCCCAACTCTCTGGG 0: 1
1: 0
2: 5
3: 62
4: 592
Right 1090173512 11:124626162-124626184 TTCCATTTAGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 249
1090173506_1090173512 3 Left 1090173506 11:124626136-124626158 CCCTTCCCCCAACTCTCTGGGTT 0: 1
1: 1
2: 2
3: 32
4: 386
Right 1090173512 11:124626162-124626184 TTCCATTTAGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 249
1090173505_1090173512 4 Left 1090173505 11:124626135-124626157 CCCCTTCCCCCAACTCTCTGGGT 0: 1
1: 0
2: 5
3: 46
4: 428
Right 1090173512 11:124626162-124626184 TTCCATTTAGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 249
1090173509_1090173512 -3 Left 1090173509 11:124626142-124626164 CCCCAACTCTCTGGGTTGCATTC 0: 1
1: 0
2: 0
3: 13
4: 200
Right 1090173512 11:124626162-124626184 TTCCATTTAGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 249
1090173507_1090173512 2 Left 1090173507 11:124626137-124626159 CCTTCCCCCAACTCTCTGGGTTG 0: 1
1: 0
2: 4
3: 36
4: 349
Right 1090173512 11:124626162-124626184 TTCCATTTAGTCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090173512 Original CRISPR TTCCATTTAGTCTTTCCTAG AGG Intronic
903615010 1:24645358-24645380 TTTCATTTTGTCATTCCTACTGG - Intronic
903783122 1:25835372-25835394 TCCAATTTAGTCTTGCCTAAGGG + Exonic
906615452 1:47230274-47230296 TTGCTTTTATTTTTTCCTAGTGG + Intronic
910680562 1:89859845-89859867 TTCCATTTTGTGCTTCCAAGAGG + Intronic
911922677 1:103786124-103786146 TTCCACTTAATCTAGCCTAGGGG + Intergenic
911922717 1:103786895-103786917 TTCCACTTAATCTAGCCTAGGGG + Intergenic
911972503 1:104455130-104455152 TTGGATTCAGCCTTTCCTAGGGG + Intergenic
912129123 1:106579660-106579682 TTCCATGTTGTTTTTCATAGCGG + Intergenic
913661366 1:121008807-121008829 TTCCATTCAGTATTCCCAAGAGG - Intergenic
914012733 1:143791987-143792009 TTCCATTCAGTATTCCCAAGAGG - Intergenic
914165097 1:145169197-145169219 TTCCATTCAGTATTCCCAAGAGG + Intergenic
914376776 1:147079433-147079455 TTCCATTCAGTATTCCCAAGAGG + Intergenic
914394350 1:147250677-147250699 TTCCACTTAGCCTTTGCTGGTGG + Intronic
914651358 1:149700596-149700618 TTCCATTCAGTATTCCCAAGAGG - Intergenic
916463802 1:165052525-165052547 TTACATTAAGTCCTTCCCAGAGG + Intergenic
916681934 1:167112861-167112883 TTCTGCTTAGTCTTTCCTATAGG - Intronic
916760665 1:167814015-167814037 TTGCATTTAATTTTTCATAGTGG - Intronic
918001486 1:180501701-180501723 ATTCATTTACTCTTTCCCAGAGG - Intronic
918190704 1:182171417-182171439 TTCCATTCATTCTTTCCTACTGG - Intergenic
919163346 1:193860474-193860496 ATACATTTAGTATTACCTAGAGG - Intergenic
919172668 1:193974964-193974986 TTCCATATTGTTTTTCATAGTGG + Intergenic
921977788 1:221221133-221221155 CTTCATTTAGACTTTCCAAGTGG - Intergenic
922011456 1:221592840-221592862 TTCCAGTAAGCCCTTCCTAGGGG + Intergenic
922941026 1:229466073-229466095 TTCCATTTAATTTTAGCTAGTGG - Intronic
924444483 1:244116549-244116571 TTGCTTCTAGTTTTTCCTAGAGG - Intergenic
1065110349 10:22435166-22435188 TTCCATTTATTGGTTCCTAGTGG - Intronic
1066473336 10:35720548-35720570 TTCCATTTAATGTTGCCAAGTGG + Intergenic
1066671422 10:37844342-37844364 TTCCATTTAGTATTTTCTGTAGG - Intronic
1068953056 10:62796590-62796612 ATCCATTTACTGTTTCTTAGGGG - Intergenic
1074119949 10:110486572-110486594 TGCAATTTATTCTTTACTAGGGG - Intergenic
1075970339 10:126646808-126646830 TTCCTTTTAGTCATTGATAGAGG - Intronic
1075970518 10:126648262-126648284 TTCCTTTTATTCATTGCTAGAGG - Intronic
1076011003 10:126988203-126988225 TTCCATTTCGTATTCCCTCGGGG + Intronic
1077558414 11:3239630-3239652 TCACATTGAGTCATTCCTAGGGG + Intergenic
1078285857 11:9954180-9954202 TTCCATTTAATTTTCCCTTGTGG + Intronic
1078487442 11:11737015-11737037 TTGTATTTATTATTTCCTAGGGG + Intergenic
1078817074 11:14836344-14836366 TTCCTTTTTCTCTTTCCTATTGG + Intronic
1079595006 11:22233476-22233498 AGCCATTTAGTCTTTCCCTGAGG + Intronic
1080193102 11:29574496-29574518 TTCTATTTGGGCTTTCCTTGGGG - Intergenic
1080977795 11:37363692-37363714 TACTATTTTGTCTTTCCAAGTGG - Intergenic
1081439629 11:43065867-43065889 TTCCTTTTAGTCTTTCTGACTGG - Intergenic
1084527802 11:69707801-69707823 TTCTATTTACCCTTTTCTAGTGG - Intergenic
1086035421 11:82409154-82409176 TTTAATTTAGGGTTTCCTAGGGG - Intergenic
1086232162 11:84582927-84582949 TTCTATTTAATCTTTCCTAAAGG + Intronic
1086826190 11:91501885-91501907 TTCCATTTAAACTTCCCAAGTGG - Intergenic
1088084888 11:105965541-105965563 TGCCATTTTGTTTTTCCTTGTGG + Intronic
1088895755 11:114077159-114077181 TTCCATTCAGTCTTTCATTCTGG + Intronic
1090173512 11:124626162-124626184 TTCCATTTAGTCTTTCCTAGAGG + Intronic
1090335747 11:125962786-125962808 TTCCATTTGGTCTTTTGTACCGG + Intronic
1090540902 11:127702946-127702968 TTCCATTTAGTATTTATTTGGGG + Intergenic
1091651089 12:2310641-2310663 TTCTATTTAGTTGTTCCTAAAGG + Intronic
1092392943 12:8097552-8097574 TTCCTTTTAGTGTTTTCTATTGG - Exonic
1094711323 12:32965820-32965842 TTCCATTTTCTCTTTCTTAAAGG - Intergenic
1096734013 12:53638414-53638436 CTCCCTTTAGTATTTCTTAGAGG + Intronic
1096994248 12:55829112-55829134 TCCCTGTTAGTCTTTCTTAGGGG - Intronic
1098501861 12:71202426-71202448 TACTATTTTGTCTTTCCAAGTGG - Intronic
1099239449 12:80121270-80121292 TTTTATTTAGTGTTTCCTTGAGG - Intergenic
1099689389 12:85932614-85932636 TTCCATTCACCCTTTCCTGGAGG - Intergenic
1099786752 12:87274337-87274359 ATCCATTTAGTCTTTTGTATAGG + Intergenic
1100275785 12:93070622-93070644 TTCCGTTTACTCTTTTCTACAGG + Intergenic
1100474078 12:94919607-94919629 TGCCAGTTAGACTTTCTTAGGGG - Intronic
1101317342 12:103641636-103641658 TTCTATTTAGACTTTCTCAGAGG - Intronic
1101645614 12:106628279-106628301 CTCCATTTAGTCTCTCCATGGGG + Intronic
1106885890 13:34183723-34183745 TTCCATTTACTCTTACCTGAAGG - Intergenic
1107026876 13:35810596-35810618 TTCCATTTGGTCTTTGTTAAAGG - Intronic
1108808309 13:54187053-54187075 TTCCCTTTATTCTTCCCTAAGGG - Intergenic
1109780150 13:67099830-67099852 TTACATTTAACCTTTGCTAGAGG - Intronic
1111669379 13:91309692-91309714 TTCCATTTTTTTTTTCCTTGAGG - Intergenic
1112385516 13:98935960-98935982 TCCCATTTAGACTTTCCTACTGG + Intronic
1114143230 14:19941665-19941687 TACCATCTTGTCTCTCCTAGTGG + Intergenic
1115330935 14:32197259-32197281 TTATATTTATTCTTTCCTAGAGG - Intergenic
1116118102 14:40682890-40682912 TACTATTTTGTCTTTCCAAGTGG + Intergenic
1116149696 14:41125378-41125400 TTCTATTTAGACTTTCTAAGTGG - Intergenic
1117457094 14:55909091-55909113 TTCCATTTAGTGTCTCCAAAGGG - Intergenic
1120523201 14:85548455-85548477 TTCTATTTGTTCTTGCCTAGAGG - Intronic
1123509544 15:20982804-20982826 TGACATTTATTCTTTACTAGAGG + Intergenic
1123566766 15:21556543-21556565 TGACATTTATTCTTTACTAGAGG + Intergenic
1123603027 15:21993836-21993858 TGACATTTATTCTTTACTAGAGG + Intergenic
1124135460 15:27031776-27031798 TTCCATTTGGTCATTACTGGAGG + Intronic
1124468411 15:29961495-29961517 TTCCATTTTATCCTCCCTAGAGG + Intronic
1124719010 15:32095645-32095667 TTCCCTTGAGTCTTCCATAGAGG - Intronic
1126310370 15:47309205-47309227 TTCCATTTAATATTTCCAAATGG - Intronic
1126636331 15:50783588-50783610 TCCCAGCTAGTCTTGCCTAGAGG + Intergenic
1126928792 15:53623275-53623297 TTCCATTTAGTAGTCCCCAGTGG + Intronic
1126944848 15:53808273-53808295 TTCCTTTTAGTCTCCACTAGAGG + Intergenic
1129834626 15:78694349-78694371 TTCCAGTTATGCTTTCCCAGTGG - Intronic
1202975127 15_KI270727v1_random:283638-283660 TGACATTTATTCTTTACTAGAGG + Intergenic
1134102060 16:11459607-11459629 TCGCTTTTAGTCTTTCCCAGAGG - Intronic
1134852856 16:17495903-17495925 TTCCAGTAGGTCTTCCCTAGAGG + Intergenic
1136585779 16:31183803-31183825 TTACATTTTCTCTTTCCTGGTGG + Intronic
1138947321 16:61867373-61867395 TTCCATTTTGGCTCTCCTACTGG - Intronic
1140773953 16:78232679-78232701 TTGAATTTAGTTTTTCCTAATGG + Intronic
1140870463 16:79101790-79101812 TTCCAGATAGTTTTTTCTAGAGG + Intronic
1143050246 17:4119428-4119450 TTCCATTTGGCCTTTCCCACCGG + Intronic
1144600955 17:16612781-16612803 TTCCTTTTAAATTTTCCTAGTGG - Intergenic
1148259626 17:46169603-46169625 TTTCATTTTCTCTTTGCTAGAGG - Intronic
1152172223 17:78759236-78759258 TACCTTTTAGTCCTTCCTCGGGG - Intronic
1155276381 18:24191852-24191874 TTCCATTTTATCCTTCCTATAGG - Intronic
1156214473 18:34981750-34981772 TTTCATGTAGTCTTGCCTGGAGG + Intronic
1157247459 18:46067145-46067167 TTTCCTTTTGTCTTGCCTAGTGG - Intronic
1158095141 18:53761919-53761941 TTCCATTTATTCTTTTCTTTTGG + Intergenic
1158981513 18:62766370-62766392 CTCACTTTAGTCTTCCCTAGGGG + Intronic
1159760714 18:72422234-72422256 TTCCATTGAGTCTTTTGAAGTGG - Intergenic
1160058172 18:75505912-75505934 TGTCATTTATTTTTTCCTAGTGG - Intergenic
1160307580 18:77754300-77754322 TTGCATTTTGGCTTTCCTATTGG + Intergenic
1161718522 19:5890906-5890928 TTCCTTTAAGACTTTCTTAGTGG - Intronic
1165297586 19:34940038-34940060 TGACATTTAGTCTTTCTTAAAGG - Intronic
1166187648 19:41151981-41152003 TTCCATTTAGCCTTTCTTATGGG - Intergenic
926623147 2:15066774-15066796 TTCCATATTGTTTTCCCTAGTGG - Intergenic
926932598 2:18055283-18055305 TTCCATGTAATCTTCTCTAGAGG + Intronic
927454027 2:23233836-23233858 TCCCCTTCAGTCTCTCCTAGTGG - Intergenic
928632390 2:33206966-33206988 TTCCTGTTAGCCTTTCCTTGGGG - Intronic
930231235 2:48845896-48845918 TTCAATTCAGTCTTGCCCAGGGG - Intergenic
931151030 2:59573637-59573659 TTCCATTTAGTTTTGCCAAGGGG - Intergenic
932369515 2:71175723-71175745 TTCCAATTATCCTTTCCCAGTGG - Intergenic
934932425 2:98437449-98437471 TACCATATAATCTATCCTAGAGG + Intergenic
935625400 2:105168468-105168490 TTCCCTTTGCTCTTTCCTGGGGG - Intergenic
936710311 2:115123362-115123384 CTCCATTTATTCTTCCCTTGGGG + Intronic
936777049 2:115986369-115986391 TACTATTTTGTCTTTCCAAGTGG + Intergenic
938637366 2:133243333-133243355 TTCAATCTAGTGTCTCCTAGAGG - Intronic
939906356 2:147920926-147920948 TTCCCTTTTGGCCTTCCTAGAGG - Intronic
940776679 2:157892033-157892055 TACCATGAAGTCTTTCCGAGGGG - Intronic
941194345 2:162429100-162429122 TTTCATTTTGTCTTTCCTGTTGG + Intronic
941755161 2:169177605-169177627 TTCTAGGTAGTCTTTCCCAGGGG + Intronic
942546500 2:177070037-177070059 TTAGATTTACTCTTTCCTAGTGG - Intergenic
942705693 2:178769429-178769451 TTTCCTTTTGTCTTTGCTAGAGG + Intronic
943984744 2:194604704-194604726 TTCCTTTTGGTATGTCCTAGGGG - Intergenic
944919443 2:204395933-204395955 TTCCATTTACTCTATCCTGGTGG + Intergenic
945132667 2:206590623-206590645 TTCCATTTAGTCTTTGATGATGG + Intronic
945237400 2:207644274-207644296 TTCCCTTTAGTATTTCTTACAGG - Intergenic
946663368 2:222024826-222024848 TTCCATTTATTCTTACCGGGTGG - Intergenic
947293022 2:228598432-228598454 TTCCTATTAGTCTCTCCTTGTGG + Intergenic
948006086 2:234608818-234608840 TTCCATTTTACTTTTCCTAGAGG - Intergenic
948223755 2:236293115-236293137 TTCCATGTCGTGTCTCCTAGTGG - Intergenic
948223761 2:236293147-236293169 TTCCATGTCGTGTCTCCTAGTGG - Intergenic
948332267 2:237179112-237179134 TTCCATTTAATCTCTCCCCGTGG - Intergenic
1169399472 20:5267741-5267763 TTCCATTAAGTCTGGCATAGGGG - Intergenic
1169616072 20:7446873-7446895 TTCCATATTGTTTTTCATAGTGG + Intergenic
1170007770 20:11687258-11687280 CTCCATTTTGTCTTTCCTGATGG + Intergenic
1170393078 20:15896029-15896051 TTACAATCATTCTTTCCTAGTGG + Intronic
1172211906 20:33205758-33205780 TCCCATTTAGACTTTATTAGTGG + Intergenic
1175759993 20:61555897-61555919 TTCCATTATGTCTTCCCTATGGG + Intronic
1177278475 21:18947625-18947647 TTCCATTGATTCTTCCCTTGGGG - Intergenic
1177731891 21:25037717-25037739 TTCCAGTTAGACTTAGCTAGGGG - Intergenic
1178888648 21:36501878-36501900 TTCCATCCAGTGTTTCCTTGTGG - Intronic
953141169 3:40230724-40230746 TTCCAGTTTGCCTTTCCCAGTGG + Intronic
954093589 3:48304252-48304274 TTCCCTTTAGTATTTCCTGCAGG + Intergenic
954569689 3:51630252-51630274 TTCCATTTTGCTTTTCCTAGAGG + Exonic
956096169 3:65718839-65718861 TTCCATCTGGTCTTTCCAATTGG + Intronic
956850878 3:73227431-73227453 TTCCCTCGAGTCTTTCCTGGGGG + Intergenic
958435553 3:94091683-94091705 TTCTATTTTGACTTTTCTAGTGG - Intronic
959044603 3:101459050-101459072 TTTCATTTTTTTTTTCCTAGTGG - Exonic
960527517 3:118726700-118726722 CTCCATATAGTATTTCCTATAGG + Intergenic
960975880 3:123173244-123173266 TTCTATTTATTTTTTCTTAGGGG + Intronic
963287502 3:143447536-143447558 TTCCAGTTAGTATTCCCTAATGG + Intronic
963416066 3:144997403-144997425 TTCCATTTAGTCCTTCCTTCAGG + Intergenic
964237604 3:154551574-154551596 TTCCATTTAGTCTCCTCAAGAGG - Intergenic
965169271 3:165240302-165240324 GTGCATTTTGTCTTTCATAGTGG - Intergenic
965437527 3:168671165-168671187 TCCCAGTTAGCCTTTCCTATTGG - Intergenic
965521944 3:169677086-169677108 TTTCACTTCTTCTTTCCTAGTGG + Intergenic
965937558 3:174133378-174133400 TCCCATTTAATCTTTCCTTCGGG + Intronic
967140039 3:186549738-186549760 TTACATATACACTTTCCTAGTGG + Intronic
967277180 3:187787552-187787574 TTCCAATTAGTTTTTCTTAAGGG - Intergenic
967507927 3:190274389-190274411 TAACATTTAGTATTTCCTGGAGG + Intergenic
969127501 4:4963510-4963532 TTCCCTCTAATCCTTCCTAGTGG + Intergenic
970104672 4:12568224-12568246 TTCCCCTTAGTCTTTCCTCCAGG + Intergenic
970449278 4:16150958-16150980 AAGCATTTTGTCTTTCCTAGTGG - Intergenic
970880671 4:20925857-20925879 TTCCAATAACTCTTTCCGAGTGG + Intronic
971151876 4:24041629-24041651 TTTCATTTAGGCTTTCAAAGGGG - Intergenic
971955234 4:33408994-33409016 ATCAATTTAATCTTTCCTGGTGG - Intergenic
972909766 4:43799697-43799719 TTCCCTTTAGTATTTCTTATAGG - Intergenic
974582519 4:63822269-63822291 TTCCAATTATTCTTTCTTAATGG - Intergenic
974611141 4:64218102-64218124 TTGCATTTTGTCTCTCCTATAGG + Intergenic
975766924 4:77678294-77678316 TTCCAGTTTGTCTTTCCCAGGGG + Intergenic
977813962 4:101391850-101391872 TTCCATACAGTTTTTCATAGAGG - Intergenic
977925336 4:102694185-102694207 TTTCATTTAGTAGTTCCCAGGGG - Intronic
978330699 4:107610077-107610099 TTCCAGTTAGTCTGTTCTTGGGG - Intronic
979973582 4:127168258-127168280 TTACATTCAGTCTATCCAAGTGG + Intergenic
981935692 4:150236995-150237017 CTCCATTTAGTGATGCCTAGGGG - Intronic
982153602 4:152492878-152492900 TGCCATTTAGCTTATCCTAGAGG - Intronic
982484298 4:155948942-155948964 TTTCATTTACTCTTACTTAGTGG - Intronic
983147417 4:164234111-164234133 TTCCATTGTGACTTTCCCAGAGG - Intronic
984596160 4:181670201-181670223 TTCCATTAAATATTACCTAGTGG - Intergenic
984840936 4:184066640-184066662 GTCCATTTGGTCTGTCCTGGAGG - Intergenic
985014911 4:185623748-185623770 TTCCATTGAGTATTTGCTGGAGG - Exonic
985081521 4:186270015-186270037 TTCCATTTACTCTTGACTGGAGG + Intronic
985426643 4:189837882-189837904 TTGCATTGAGTCTTACCTTGGGG + Intergenic
985905580 5:2832951-2832973 TTCAATTAAGACTTTCCTAATGG - Intergenic
988892550 5:35634177-35634199 TTCCCTTTAGTATTTCTTATAGG + Intronic
991637690 5:68722772-68722794 TTCCAATTAGTTTTGGCTAGGGG + Intergenic
992257890 5:74940154-74940176 TTCCATATTGTTTTTCATAGAGG - Intergenic
992646401 5:78815738-78815760 TTCCCTTTATTCATTCCTTGTGG - Intronic
993659160 5:90609021-90609043 TTCCATGTAGACTTTCCTGTTGG - Intronic
994172590 5:96674115-96674137 TTCCATTTAGTGTGTTCTAGTGG + Intronic
994320045 5:98384654-98384676 TTCCCTTTAGTGTTTCTTATAGG + Intergenic
994609039 5:102012405-102012427 TTCCATCTCTTCTTTGCTAGTGG + Intergenic
995415629 5:111909675-111909697 TTCCATTTATCCTTTCATAATGG + Intronic
1000527893 5:162381078-162381100 CTGCATGTAGTCTTTCCTAAAGG + Intergenic
1000907986 5:166986667-166986689 TTTCATTCAGTAATTCCTAGAGG - Intergenic
1003382192 6:5635219-5635241 TTACAATTAGTTTTTCCCAGAGG - Intronic
1009294116 6:61922553-61922575 TTCCTTCTAGTCTTTTCTGGTGG - Intronic
1009473615 6:64059929-64059951 TTCCATCTGGTATTTCTTAGAGG - Intronic
1010014627 6:71090313-71090335 TTCCATTTAGTATTTTCAAATGG + Intergenic
1011499545 6:87972806-87972828 TTCCCATTAGTGTTTCCTCGAGG - Intergenic
1011738753 6:90338415-90338437 TTCTGATGAGTCTTTCCTAGTGG + Intergenic
1011783534 6:90818011-90818033 TTCCATATAGTTTTCCATAGTGG + Intergenic
1013494834 6:110688415-110688437 CACTATTTTGTCTTTCCTAGTGG - Intronic
1015436962 6:133200571-133200593 TTCAATTTAGGGTTTCATAGGGG + Intergenic
1016049382 6:139514433-139514455 TTCAATTTAGTCTTTACTTATGG + Intergenic
1018236497 6:161729255-161729277 GTCCTTTTAGTGTTACCTAGTGG - Intronic
1018460454 6:163993916-163993938 TTTCATTTTGTCTTTCCTTGGGG - Intergenic
1020701097 7:11484427-11484449 TTCAATTTTCTCCTTCCTAGAGG + Intronic
1020975040 7:14995562-14995584 TTCCTTTTAGTCTCTCTAAGTGG + Intergenic
1021205733 7:17777806-17777828 TTCCATTTTATCTTCTCTAGTGG - Intergenic
1023191015 7:37583145-37583167 TTCCTTTTAGTGTTTTCTATTGG + Intergenic
1023667821 7:42542987-42543009 TTCCATTCAGTCAGTTCTAGGGG + Intergenic
1023853589 7:44165512-44165534 TTCCCTTTAGCATTTCCTATAGG - Intronic
1024924766 7:54601100-54601122 TTCCATCTAGCCTTTTCTACTGG - Intergenic
1027158204 7:75783377-75783399 TTCCATTTTGGATCTCCTAGGGG - Intronic
1028280434 7:88919481-88919503 ATCCATTTGGTCTCTTCTAGAGG + Intronic
1028358552 7:89939045-89939067 CTCCATTTTGTTTTTCATAGAGG + Intergenic
1029356728 7:100057593-100057615 TTTCCTTTTCTCTTTCCTAGAGG + Intronic
1029926701 7:104326986-104327008 TTCCATTCAGTTTTTTCTATAGG - Intergenic
1029963878 7:104717723-104717745 TGCCATATAGTTTTTCATAGTGG - Intronic
1030285519 7:107822845-107822867 TTCCTTTTTGTCTTTCCTGTTGG + Intergenic
1033069873 7:138192323-138192345 TTCTCTGTAGTCTTTCCTTGTGG - Intergenic
1034895264 7:154872381-154872403 TTCCATTCAGTCTTGCATATGGG - Intronic
1036032069 8:4984936-4984958 TTCCATTTTGACTTTGCCAGTGG - Intronic
1036463862 8:8978287-8978309 TTCCAGTTGTTCTTTCCCAGTGG - Intergenic
1037479135 8:19287863-19287885 CTCTATTTTGTCTTTCCAAGGGG + Intergenic
1039788909 8:40858592-40858614 TTCCAGTTAGTCATTCCTCTGGG - Intronic
1041444538 8:57935961-57935983 TTTCATTAAGTATTTCATAGAGG - Intergenic
1042717867 8:71794476-71794498 TTTCACTTAGCCTTTCCTGGAGG + Intergenic
1044493991 8:92854615-92854637 TTCCATGCTGTTTTTCCTAGTGG - Intergenic
1046228640 8:111322135-111322157 TTCCATATTGTTTTTCATAGTGG - Intergenic
1046392661 8:113596693-113596715 TTCTATCTAGTCTTTCTAAGCGG + Intergenic
1046594358 8:116243391-116243413 TTGCATTTTGTCTTTCCTACTGG + Intergenic
1048471225 8:134705976-134705998 TTTCATTTTGCCTTCCCTAGAGG - Intronic
1050413940 9:5395069-5395091 TTACACTTAGATTTTCCTAGTGG + Intronic
1050953326 9:11625077-11625099 TTCCATTTAGTAGTTGTTAGAGG + Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1055424736 9:76182426-76182448 TTCCATTTTGCCTTTCCTGGTGG - Intronic
1056247744 9:84713993-84714015 TTCCATTTATTCTTTCATTCAGG + Intronic
1057340774 9:94199195-94199217 CACCATTTTGTCTTTCCAAGTGG + Intergenic
1058015626 9:100029590-100029612 CTCCATTTTGTCTTCCATAGTGG - Intronic
1058859943 9:109106520-109106542 TTCCATTCTGTTTTTCATAGAGG + Exonic
1059440321 9:114302922-114302944 GCCCATTCAGTCTTTCCTCGAGG - Intronic
1185680485 X:1884885-1884907 TTTCATTTAGCCTTCTCTAGAGG + Intergenic
1185811289 X:3112959-3112981 TTCCATTTGCTGTTTCCTTGAGG + Intergenic
1187258220 X:17660625-17660647 CTCCACATAGTCTTTCCCAGTGG + Intronic
1187795445 X:22999101-22999123 TTCCATTTAGACACTCCCAGAGG - Intergenic
1188175578 X:26984839-26984861 TTCCATATTGTTTTTACTAGTGG - Intergenic
1188711258 X:33402497-33402519 TTCCATTTTGTAATTCCCAGAGG + Intergenic
1192738758 X:73873738-73873760 TACCATATGGTCTATCCTAGAGG - Intergenic
1194290844 X:92070332-92070354 TTCCCTTTAGTATTTCTTATAGG + Intronic
1195230012 X:102837217-102837239 TTCCGTTTAGGCTTCCCAAGTGG + Intergenic
1195438118 X:104868684-104868706 TTCCAATTAATCTTTGCAAGGGG + Intronic
1195703185 X:107720322-107720344 ATCCATTCATTCTTTCCTAATGG - Intronic
1197496080 X:127182988-127183010 TAACTTTTAGTCTTTCCTATGGG - Intergenic
1197538438 X:127723217-127723239 TACTATTTTGTCTTTCCAAGAGG + Intergenic
1198045421 X:132896997-132897019 TTTCAGTTAGTCTTTCCTGATGG - Intronic
1198929436 X:141837773-141837795 TGCCATTTTGTCTTACCAAGTGG + Intergenic
1200093660 X:153647432-153647454 TTCCTTTTGTTCTCTCCTAGGGG + Intronic
1200442175 Y:3223625-3223647 TTCCTTTCAGTCTTCCCTAAAGG + Intergenic
1200466383 Y:3525739-3525761 TTCCTTTAAGTATTTCCTATGGG + Intergenic
1200608357 Y:5294909-5294931 TTCCCTTTAGTATTTCTTATAGG + Intronic