ID: 1090178770

View in Genome Browser
Species Human (GRCh38)
Location 11:124674684-124674706
Sequence TGCGTGCGTGTGTGTGAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9311
Summary {0: 1, 1: 1, 2: 57, 3: 784, 4: 8468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090178770_1090178773 1 Left 1090178770 11:124674684-124674706 CCTCCCTCACACACACGCACGCA 0: 1
1: 1
2: 57
3: 784
4: 8468
Right 1090178773 11:124674708-124674730 AACCCCATTCCACAGTACGAAGG 0: 1
1: 0
2: 0
3: 1
4: 55
1090178770_1090178778 18 Left 1090178770 11:124674684-124674706 CCTCCCTCACACACACGCACGCA 0: 1
1: 1
2: 57
3: 784
4: 8468
Right 1090178778 11:124674725-124674747 CGAAGGTGTTCGAAGCATTGTGG 0: 1
1: 0
2: 0
3: 2
4: 57
1090178770_1090178779 19 Left 1090178770 11:124674684-124674706 CCTCCCTCACACACACGCACGCA 0: 1
1: 1
2: 57
3: 784
4: 8468
Right 1090178779 11:124674726-124674748 GAAGGTGTTCGAAGCATTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090178770 Original CRISPR TGCGTGCGTGTGTGTGAGGG AGG (reversed) Exonic