ID: 1090183270

View in Genome Browser
Species Human (GRCh38)
Location 11:124719005-124719027
Sequence CCACGTGACAAGATGGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090183258_1090183270 19 Left 1090183258 11:124718963-124718985 CCTGTGCCCCCAGGACTCTTGAG No data
Right 1090183270 11:124719005-124719027 CCACGTGACAAGATGGCCAAGGG No data
1090183262_1090183270 11 Left 1090183262 11:124718971-124718993 CCCAGGACTCTTGAGAGTCTGGA No data
Right 1090183270 11:124719005-124719027 CCACGTGACAAGATGGCCAAGGG No data
1090183260_1090183270 12 Left 1090183260 11:124718970-124718992 CCCCAGGACTCTTGAGAGTCTGG No data
Right 1090183270 11:124719005-124719027 CCACGTGACAAGATGGCCAAGGG No data
1090183255_1090183270 29 Left 1090183255 11:124718953-124718975 CCGTCTGGACCCTGTGCCCCCAG No data
Right 1090183270 11:124719005-124719027 CCACGTGACAAGATGGCCAAGGG No data
1090183259_1090183270 13 Left 1090183259 11:124718969-124718991 CCCCCAGGACTCTTGAGAGTCTG No data
Right 1090183270 11:124719005-124719027 CCACGTGACAAGATGGCCAAGGG No data
1090183257_1090183270 20 Left 1090183257 11:124718962-124718984 CCCTGTGCCCCCAGGACTCTTGA No data
Right 1090183270 11:124719005-124719027 CCACGTGACAAGATGGCCAAGGG No data
1090183263_1090183270 10 Left 1090183263 11:124718972-124718994 CCAGGACTCTTGAGAGTCTGGAC No data
Right 1090183270 11:124719005-124719027 CCACGTGACAAGATGGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090183270 Original CRISPR CCACGTGACAAGATGGCCAA GGG Intergenic
No off target data available for this crispr