ID: 1090183477

View in Genome Browser
Species Human (GRCh38)
Location 11:124720539-124720561
Sequence ATCAGATGCTGGGAATATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090183473_1090183477 28 Left 1090183473 11:124720488-124720510 CCTTTTCTCATATATGCAACACT No data
Right 1090183477 11:124720539-124720561 ATCAGATGCTGGGAATATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090183477 Original CRISPR ATCAGATGCTGGGAATATAA TGG Intergenic
No off target data available for this crispr