ID: 1090184969

View in Genome Browser
Species Human (GRCh38)
Location 11:124732121-124732143
Sequence CTGCTGTTTATGAGGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090184969_1090184973 7 Left 1090184969 11:124732121-124732143 CCTTAATTCCTCATAAACAGCAG No data
Right 1090184973 11:124732151-124732173 GTGGTCTTCGTCTACCCCACAGG No data
1090184969_1090184977 28 Left 1090184969 11:124732121-124732143 CCTTAATTCCTCATAAACAGCAG No data
Right 1090184977 11:124732172-124732194 GGCTGCCGCTTTGACCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090184969 Original CRISPR CTGCTGTTTATGAGGAATTA AGG (reversed) Intergenic
No off target data available for this crispr