ID: 1090185683

View in Genome Browser
Species Human (GRCh38)
Location 11:124737940-124737962
Sequence GGGTGTCTCTGAACACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090185683_1090185694 11 Left 1090185683 11:124737940-124737962 CCCTCCAGTGTTCAGAGACACCC No data
Right 1090185694 11:124737974-124737996 AAAGGTGTCCTTCAGGAAGAGGG No data
1090185683_1090185686 -7 Left 1090185683 11:124737940-124737962 CCCTCCAGTGTTCAGAGACACCC No data
Right 1090185686 11:124737956-124737978 GACACCCTCACCCCACACAAAGG No data
1090185683_1090185695 15 Left 1090185683 11:124737940-124737962 CCCTCCAGTGTTCAGAGACACCC No data
Right 1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG No data
1090185683_1090185693 10 Left 1090185683 11:124737940-124737962 CCCTCCAGTGTTCAGAGACACCC No data
Right 1090185693 11:124737973-124737995 CAAAGGTGTCCTTCAGGAAGAGG No data
1090185683_1090185696 16 Left 1090185683 11:124737940-124737962 CCCTCCAGTGTTCAGAGACACCC No data
Right 1090185696 11:124737979-124738001 TGTCCTTCAGGAAGAGGGAAGGG No data
1090185683_1090185691 4 Left 1090185683 11:124737940-124737962 CCCTCCAGTGTTCAGAGACACCC No data
Right 1090185691 11:124737967-124737989 CCCACACAAAGGTGTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090185683 Original CRISPR GGGTGTCTCTGAACACTGGA GGG (reversed) Intergenic
No off target data available for this crispr