ID: 1090185685

View in Genome Browser
Species Human (GRCh38)
Location 11:124737944-124737966
Sequence GTGAGGGTGTCTCTGAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090185685_1090185691 0 Left 1090185685 11:124737944-124737966 CCAGTGTTCAGAGACACCCTCAC No data
Right 1090185691 11:124737967-124737989 CCCACACAAAGGTGTCCTTCAGG No data
1090185685_1090185698 29 Left 1090185685 11:124737944-124737966 CCAGTGTTCAGAGACACCCTCAC No data
Right 1090185698 11:124737996-124738018 GAAGGGCTGTGCTGCCTGTGTGG No data
1090185685_1090185693 6 Left 1090185685 11:124737944-124737966 CCAGTGTTCAGAGACACCCTCAC No data
Right 1090185693 11:124737973-124737995 CAAAGGTGTCCTTCAGGAAGAGG No data
1090185685_1090185696 12 Left 1090185685 11:124737944-124737966 CCAGTGTTCAGAGACACCCTCAC No data
Right 1090185696 11:124737979-124738001 TGTCCTTCAGGAAGAGGGAAGGG No data
1090185685_1090185695 11 Left 1090185685 11:124737944-124737966 CCAGTGTTCAGAGACACCCTCAC No data
Right 1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG No data
1090185685_1090185699 30 Left 1090185685 11:124737944-124737966 CCAGTGTTCAGAGACACCCTCAC No data
Right 1090185699 11:124737997-124738019 AAGGGCTGTGCTGCCTGTGTGGG No data
1090185685_1090185694 7 Left 1090185685 11:124737944-124737966 CCAGTGTTCAGAGACACCCTCAC No data
Right 1090185694 11:124737974-124737996 AAAGGTGTCCTTCAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090185685 Original CRISPR GTGAGGGTGTCTCTGAACAC TGG (reversed) Intergenic
No off target data available for this crispr