ID: 1090185687

View in Genome Browser
Species Human (GRCh38)
Location 11:124737960-124737982
Sequence GACACCTTTGTGTGGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090185687_1090185708 29 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185708 11:124738012-124738034 TGTGTGGGAGTTGGTGGGGGGGG No data
1090185687_1090185696 -4 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185696 11:124737979-124738001 TGTCCTTCAGGAAGAGGGAAGGG No data
1090185687_1090185698 13 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185698 11:124737996-124738018 GAAGGGCTGTGCTGCCTGTGTGG No data
1090185687_1090185707 28 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185707 11:124738011-124738033 CTGTGTGGGAGTTGGTGGGGGGG No data
1090185687_1090185702 24 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185702 11:124738007-124738029 CTGCCTGTGTGGGAGTTGGTGGG No data
1090185687_1090185704 26 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185704 11:124738009-124738031 GCCTGTGTGGGAGTTGGTGGGGG No data
1090185687_1090185703 25 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185703 11:124738008-124738030 TGCCTGTGTGGGAGTTGGTGGGG No data
1090185687_1090185699 14 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185699 11:124737997-124738019 AAGGGCTGTGCTGCCTGTGTGGG No data
1090185687_1090185706 27 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185706 11:124738010-124738032 CCTGTGTGGGAGTTGGTGGGGGG No data
1090185687_1090185694 -9 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185694 11:124737974-124737996 AAAGGTGTCCTTCAGGAAGAGGG No data
1090185687_1090185701 23 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185701 11:124738006-124738028 GCTGCCTGTGTGGGAGTTGGTGG No data
1090185687_1090185693 -10 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185693 11:124737973-124737995 CAAAGGTGTCCTTCAGGAAGAGG No data
1090185687_1090185695 -5 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG No data
1090185687_1090185700 20 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185700 11:124738003-124738025 TGTGCTGCCTGTGTGGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090185687 Original CRISPR GACACCTTTGTGTGGGGTGA GGG (reversed) Intergenic
No off target data available for this crispr