ID: 1090185695

View in Genome Browser
Species Human (GRCh38)
Location 11:124737978-124738000
Sequence GTGTCCTTCAGGAAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090185682_1090185695 23 Left 1090185682 11:124737932-124737954 CCTATGGGCCCTCCAGTGTTCAG No data
Right 1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG No data
1090185683_1090185695 15 Left 1090185683 11:124737940-124737962 CCCTCCAGTGTTCAGAGACACCC No data
Right 1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG No data
1090185684_1090185695 14 Left 1090185684 11:124737941-124737963 CCTCCAGTGTTCAGAGACACCCT No data
Right 1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG No data
1090185687_1090185695 -5 Left 1090185687 11:124737960-124737982 CCCTCACCCCACACAAAGGTGTC No data
Right 1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG No data
1090185688_1090185695 -6 Left 1090185688 11:124737961-124737983 CCTCACCCCACACAAAGGTGTCC No data
Right 1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG No data
1090185685_1090185695 11 Left 1090185685 11:124737944-124737966 CCAGTGTTCAGAGACACCCTCAC No data
Right 1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090185695 Original CRISPR GTGTCCTTCAGGAAGAGGGA AGG Intergenic
No off target data available for this crispr