ID: 1090186256

View in Genome Browser
Species Human (GRCh38)
Location 11:124740749-124740771
Sequence CAGCGCCCACGCGGAAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090186253_1090186256 12 Left 1090186253 11:124740714-124740736 CCTGCTGGCGAGGAAAGGAAGTG 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1090186256 11:124740749-124740771 CAGCGCCCACGCGGAAACCTGGG 0: 1
1: 0
2: 1
3: 1
4: 84
1090186252_1090186256 13 Left 1090186252 11:124740713-124740735 CCCTGCTGGCGAGGAAAGGAAGT 0: 1
1: 0
2: 2
3: 9
4: 155
Right 1090186256 11:124740749-124740771 CAGCGCCCACGCGGAAACCTGGG 0: 1
1: 0
2: 1
3: 1
4: 84
1090186249_1090186256 24 Left 1090186249 11:124740702-124740724 CCGCGAGAGAGCCCTGCTGGCGA 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1090186256 11:124740749-124740771 CAGCGCCCACGCGGAAACCTGGG 0: 1
1: 0
2: 1
3: 1
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090186256 Original CRISPR CAGCGCCCACGCGGAAACCT GGG Intronic
900181471 1:1312892-1312914 CAGCGCACACGCGGACGCCAAGG - Exonic
906379156 1:45320747-45320769 CAGGGCCCACACTGAATCCTGGG + Intergenic
908794363 1:67816583-67816605 CAGGGCCCACCTGGAAACCTGGG - Intronic
911139415 1:94482668-94482690 CAGCTCCCAGGAGGAAACCCTGG - Intronic
912800206 1:112715356-112715378 CACCGCCCACGCGGAGCCATGGG - Exonic
914930480 1:151927185-151927207 CAGAGCCCACCCTGAATCCTGGG - Intergenic
916624042 1:166534436-166534458 CAGTGCCCACACTGAATCCTGGG + Intergenic
922677431 1:227561389-227561411 CTGCGCCCTCGCGGTACCCTGGG + Intergenic
1065496452 10:26333657-26333679 CAGAGCCCACACTGAATCCTGGG - Intergenic
1072741694 10:97913792-97913814 CAGCGCCCACCTGGGAAGCTAGG + Intronic
1074649565 10:115505222-115505244 CAGAGCCCACACTGAATCCTGGG + Intronic
1075800309 10:125149593-125149615 CAGAGCCCCAGCGGAAACCAAGG + Intronic
1075997934 10:126893313-126893335 CAGCGGCCACGCCGACAGCTAGG - Intergenic
1078840731 11:15073878-15073900 CAGCGCCCACGCTGAGCCATGGG - Intronic
1081538943 11:44016269-44016291 CAGCCACCACCCGGCAACCTGGG - Intergenic
1084435176 11:69135289-69135311 CTGCATCCACGCGGGAACCTGGG + Intergenic
1087145797 11:94810320-94810342 CAGAGCCCACACTGAATCCTGGG + Intronic
1090100600 11:123792776-123792798 CAGAGCCCACACTGAATCCTCGG + Intergenic
1090186256 11:124740749-124740771 CAGCGCCCACGCGGAAACCTGGG + Intronic
1101341102 12:103841889-103841911 CTGCCGCCAGGCGGAAACCTAGG - Intronic
1116013669 14:39380833-39380855 CAGAGCCCACACTGAAACCCTGG + Intronic
1119650156 14:76377413-76377435 CAGCGCCCAAGGGGAGACCCGGG - Intronic
1122434274 14:101682941-101682963 CAGAGCCCACACTGAATCCTGGG + Intergenic
1132573332 16:653520-653542 CAGCGCCAGGGCGGAGACCTAGG - Exonic
1140458748 16:75121057-75121079 CAGAGCCCACACTGAATCCTGGG - Intergenic
1145935200 17:28711189-28711211 CAGCGCCCACCCGGACGCCGGGG - Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1149472306 17:56927128-56927150 CAGAGCCCACACTGAATCCTGGG - Intergenic
1151560894 17:74869006-74869028 CAGAGCCCAAGCTGGAACCTGGG + Intronic
1152892301 17:82889384-82889406 CAGCACCCACGCGGAGGCCCCGG - Intronic
1161115392 19:2494066-2494088 CAGGACCCACGCAGAAACCCAGG + Intergenic
1162013530 19:7831501-7831523 CAGCGCCCACACTGGAGCCTTGG + Intronic
1168352885 19:55686598-55686620 CAGCACCCACGGGGAGACATGGG + Intronic
926646115 2:15291582-15291604 CAAGGCCCAGGCGGAGACCTTGG - Intronic
935152934 2:100454733-100454755 CAGAGCCCACACTGAATCCTGGG - Intergenic
935638209 2:105266822-105266844 CAGAGCCCACGAGGTAACCCTGG + Exonic
942277416 2:174333422-174333444 CAGCGCCCTCGGGCAGACCTGGG - Intergenic
949029444 2:241785045-241785067 CAGAGCCCACACTGAATCCTGGG + Intronic
1174764540 20:53240299-53240321 CAGCGCCCACACATAGACCTGGG + Intronic
954623048 3:52006538-52006560 CAGGGCCCAGGCAGAAGCCTGGG + Intergenic
955688169 3:61564690-61564712 CAGCGGCGTCGCGGCAACCTCGG - Intronic
961077083 3:123992229-123992251 CAGCGCCCTAGCGGGACCCTGGG - Intergenic
961307493 3:125969071-125969093 CAGCGCCCTAGCGGGACCCTGGG + Intergenic
961352688 3:126314175-126314197 CAGCCCCCATGAGGAATCCTGGG - Intergenic
964641644 3:158915264-158915286 CATCGCCTAAGGGGAAACCTTGG + Intergenic
967244551 3:187472110-187472132 CAGAGCCCACACTGAATCCTGGG - Intergenic
969540837 4:7787935-7787957 CAGCACCCACGCGGAGACCTGGG - Intronic
970480152 4:16464430-16464452 CAGCCCCCCCGTGAAAACCTTGG + Intergenic
971913595 4:32828784-32828806 CAGAGCCCACACTGAATCCTGGG + Intergenic
973245797 4:48010307-48010329 CAGAGCCCACACTGAATCCTGGG + Intronic
977720495 4:100235004-100235026 CAGAGCCCACACTGAATCCTGGG + Intergenic
978357207 4:107889945-107889967 CAGAGCCCACACTGAATCCTGGG + Intronic
992292552 5:75293923-75293945 CAGAGCCCACACTGAATCCTGGG - Intergenic
999358461 5:150959450-150959472 CAGAGCCCACACTGAATCCTGGG - Intergenic
1000363132 5:160466637-160466659 CAGAGCCCACTCAGATACCTGGG + Intergenic
1004646523 6:17567486-17567508 CAGAGCCCACACTGAATCCTGGG + Intergenic
1006932949 6:37698445-37698467 CAGAGCCCCCGCCGAAACCCAGG - Intronic
1008650630 6:53557716-53557738 CAGAGCCCACACTGAATCCTGGG - Intronic
1008885795 6:56430792-56430814 CAGCGCACACGCAGAGAGCTCGG + Intergenic
1015194782 6:130513818-130513840 CAGCAGACAAGCGGAAACCTGGG - Intergenic
1017889438 6:158626511-158626533 CAGAGCCCACCTGGAAAGCTTGG - Intronic
1024821748 7:53338857-53338879 CAGAGCCCACACTGAATCCTAGG - Intergenic
1025797348 7:64751781-64751803 CAGAGCCCACACTGAATCCTCGG + Intergenic
1031227524 7:119059498-119059520 CAGAGCCCACACTGAATCCTGGG + Intergenic
1032533110 7:132638061-132638083 CAGGGCCCAGGCTGAAGCCTGGG + Intronic
1035264761 7:157684794-157684816 CAGCGCCCGCGCGGGGACCGAGG - Intronic
1036793693 8:11740459-11740481 CAGTCCCCACCCCGAAACCTGGG - Intronic
1037902199 8:22694765-22694787 CCGCGCCCACGCGGCCACCGAGG - Intergenic
1037979654 8:23242406-23242428 CAGAGCCCACACTGAATCCTGGG - Intergenic
1039500519 8:38012980-38013002 CAGAGCCCACACTGAATCCTGGG - Intergenic
1040423109 8:47259468-47259490 CACAGCTCACGCAGAAACCTAGG - Intergenic
1040991163 8:53351830-53351852 CAGAGCCCACACTGAATCCTGGG + Intergenic
1046385600 8:113505497-113505519 CAGAGCCCACACTGAATCCTGGG + Intergenic
1047201411 8:122770750-122770772 CAGTGGCCACATGGAAACCTAGG - Intergenic
1049448771 8:142647179-142647201 CAGAGCCCACACTGAATCCTGGG + Intergenic
1056448017 9:86685381-86685403 CAGAATACACGCGGAAACCTTGG - Intergenic
1059383428 9:113946203-113946225 TAGCCCCCTCACGGAAACCTGGG + Intronic
1185454556 X:302131-302153 CAGGGCACAAGCGGATACCTGGG - Exonic
1186505389 X:10087491-10087513 AACAGCCCACGCGAAAACCTCGG + Intronic
1193532089 X:82668035-82668057 CAGAGCCCACACTGAATCCTGGG + Intergenic
1194044478 X:88984713-88984735 CAGAGCCCACACTGAATCCTGGG - Intergenic
1194886801 X:99325464-99325486 CAGAGCCCACACTGAATCCTGGG - Intergenic
1196074462 X:111560227-111560249 CAGAGCCCACACTGAATCCTGGG + Intergenic
1197568563 X:128119712-128119734 CAGAGCCCACACTGAATCCTGGG + Intergenic
1198877849 X:141246751-141246773 CAGAGCCCACACTGAATCCTAGG + Intergenic
1198908249 X:141585439-141585461 CAGAGCCCACACTGAATCCTAGG - Intronic