ID: 1090188332

View in Genome Browser
Species Human (GRCh38)
Location 11:124752254-124752276
Sequence CTGGTATCTCAGAGCAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090188322_1090188332 13 Left 1090188322 11:124752218-124752240 CCCAAGGGCAGCCGCCCGGGCTG 0: 1
1: 0
2: 1
3: 6
4: 200
Right 1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG 0: 1
1: 0
2: 2
3: 20
4: 176
1090188327_1090188332 2 Left 1090188327 11:124752229-124752251 CCGCCCGGGCTGGGCAGGAGCGA 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG 0: 1
1: 0
2: 2
3: 20
4: 176
1090188329_1090188332 -2 Left 1090188329 11:124752233-124752255 CCGGGCTGGGCAGGAGCGAGACT 0: 1
1: 0
2: 57
3: 678
4: 2793
Right 1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG 0: 1
1: 0
2: 2
3: 20
4: 176
1090188328_1090188332 -1 Left 1090188328 11:124752232-124752254 CCCGGGCTGGGCAGGAGCGAGAC 0: 1
1: 0
2: 3
3: 41
4: 392
Right 1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG 0: 1
1: 0
2: 2
3: 20
4: 176
1090188323_1090188332 12 Left 1090188323 11:124752219-124752241 CCAAGGGCAGCCGCCCGGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 306
Right 1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG 0: 1
1: 0
2: 2
3: 20
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090188332 Original CRISPR CTGGTATCTCAGAGCAAACA GGG Intergenic
900471636 1:2857835-2857857 CTTGCATCTCAGAGCACCCACGG - Intergenic
903285534 1:22274678-22274700 CTGGTAGCACAGAGCAGTCAAGG - Intergenic
903548788 1:24143247-24143269 CTGGAATTCCAGAGCACACAGGG - Intergenic
905593925 1:39189061-39189083 CAGGTGTCTCAGTGAAAACAGGG - Intronic
906850752 1:49247583-49247605 CTGGAATCTCAGAAAAAAAAGGG - Intronic
908291970 1:62676766-62676788 CTGGTGTCACAGGGCAAACCAGG + Intronic
908626717 1:66052835-66052857 CTGGATTCTCAGAGGAAACCTGG - Intronic
909286225 1:73822406-73822428 CATGGATCTGAGAGCAAACAGGG + Intergenic
913610969 1:120509545-120509567 CTGGTGTCTCACAGCAGCCAAGG + Intergenic
913683186 1:121206529-121206551 CAGGCAACTCAGAGCAACCAGGG - Intronic
914035027 1:143994154-143994176 CAGGCAACTCAGAGCAACCAGGG - Intergenic
914154426 1:145073817-145073839 CAGGCAACTCAGAGCAACCAGGG + Intronic
914580219 1:149012694-149012716 CTGGTGTCTCACAGCAGCCAAGG - Exonic
915748505 1:158183050-158183072 ATGGTATCTCCGAGCAACCCTGG + Exonic
915762516 1:158329454-158329476 ATGGTATCTCCGAGCAACCCTGG - Exonic
915765284 1:158355999-158356021 ATGGTATCTCCGAGCAACCCTGG + Exonic
916890696 1:169109500-169109522 CTAACATCTCAGAGCAAAAAGGG + Intronic
917324874 1:173822301-173822323 ATGGAATGTCAGAGGAAACAAGG - Intronic
918554942 1:185787494-185787516 CTGTTGTCTGAGAGCTAACAGGG + Intronic
920470496 1:206225039-206225061 CAGGCAACTCAGAGCAACCAGGG - Intronic
924725639 1:246667999-246668021 GTGGTGTCTCAGAGAAACCATGG + Exonic
924920718 1:248626591-248626613 CTGGGATCTCACAGAAAAAATGG + Exonic
1063312953 10:4972661-4972683 CTGGTAGCGCAGGGCAATCAGGG - Exonic
1063315040 10:4995385-4995407 CTGGTAGCGCAGGGCAATCAGGG + Exonic
1063325959 10:5102562-5102584 CTGGTAGCGCAGGGCAATCAGGG - Exonic
1063327899 10:5123340-5123362 CTGGTAGCACAGAGCAATCAGGG + Intronic
1063335896 10:5213071-5213093 CTGGTAGCGCAGGGCAATCAGGG - Exonic
1063351746 10:5362877-5362899 CTGGCATCTCAGAGCCCATAAGG + Intergenic
1063355299 10:5393597-5393619 CTGGTACCTCAGAGAAGGCATGG - Exonic
1064140059 10:12782926-12782948 CTGTTATCTCAGATCCAGCATGG - Intronic
1064466309 10:15585618-15585640 CTGGTTTTTCAGAACAATCATGG - Intronic
1066663432 10:37759074-37759096 CAGGTTTCTCACAGCCAACAAGG + Intergenic
1067295860 10:44974963-44974985 CTGGTATCTCAAAAGAAAAAAGG + Intronic
1068433681 10:56963757-56963779 CAGGTTTCTCCGAGAAAACAAGG + Intergenic
1068781835 10:60927815-60927837 CTGAGATCTCACAGCAAAAATGG + Intronic
1069424135 10:68274853-68274875 CTGGTCTCACAGACCAATCATGG + Intergenic
1070480784 10:76880814-76880836 CTGGTATGTGAGATGAAACAGGG - Intronic
1071150908 10:82633349-82633371 CAGGTTTCTCTGAGCAAAGAAGG + Intronic
1079687407 11:23376942-23376964 CAAGTATTTGAGAGCAAACAGGG + Intergenic
1079997445 11:27309323-27309345 CTGGTATGTTAGAGCCAAAAAGG - Intergenic
1080443542 11:32316780-32316802 CAGGTAACGCAGAGCAAAGAGGG + Intergenic
1081074752 11:38657236-38657258 CTGGTATCTAATAGCTAATATGG + Intergenic
1083967141 11:66049806-66049828 CTGGGATTTAAGAGCAAACCAGG - Intergenic
1085455500 11:76663112-76663134 CAGCGAGCTCAGAGCAAACAGGG + Intronic
1085720541 11:78908748-78908770 CTAGCATCTCAGAGCAAACCAGG + Intronic
1085973950 11:81629022-81629044 AAGGTATCTCAGAGCAATAATGG - Intergenic
1086404258 11:86486679-86486701 CTCTTCTCTCAGAGTAAACATGG + Intronic
1088523721 11:110728560-110728582 CTGGAATCCCAGTGCAGACAAGG - Intergenic
1088622815 11:111704074-111704096 TTGGTCTTTCACAGCAAACAAGG - Intronic
1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG + Intergenic
1091195513 11:133727603-133727625 TTCCTATCTCTGAGCAAACATGG + Intergenic
1091987045 12:4918967-4918989 CTTTTATGTCAGAGCAAACAGGG + Intronic
1092709749 12:11323269-11323291 CTGGTTTCTCTTATCAAACAGGG - Intergenic
1094004469 12:25734037-25734059 CTGTTATCCCAGAGTAACCATGG - Intergenic
1099260487 12:80374779-80374801 ATGTTATCTCAGGGCAGACAGGG + Intronic
1099768910 12:87027437-87027459 TTGGTAACACAGAGTAAACATGG + Intergenic
1100017618 12:90030385-90030407 CAGGTATCTAAAACCAAACATGG + Intergenic
1101567827 12:105925803-105925825 CTGGAATATGAAAGCAAACAGGG - Intergenic
1101999385 12:109547345-109547367 CTGGTTGCTGAGATCAAACAAGG + Intergenic
1102796299 12:115691745-115691767 CTGCTATCTCAAAGCGAAAAGGG + Intergenic
1103916031 12:124376163-124376185 CTGATCTCTCAGAGCAGCCACGG + Intronic
1104409494 12:128546473-128546495 CTGGAAGCTCAGAACAAACAGGG - Intronic
1104636548 12:130441022-130441044 CTGCTATCTCCGCTCAAACAGGG - Intronic
1110375376 13:74787387-74787409 GTGGTATCTCAGACCTAGCAGGG + Intergenic
1110783564 13:79495856-79495878 TTGTAATCTAAGAGCAAACATGG - Intronic
1110856200 13:80299427-80299449 CTGTTATCTCTGAGGAAACAAGG - Intergenic
1111838504 13:93420279-93420301 CTGGGATCAGAGAGCAAACTAGG - Intronic
1116168667 14:41369478-41369500 CTGTAATTTCAGAGCAAGCATGG + Intergenic
1118270979 14:64341955-64341977 GTGTTAACTCTGAGCAAACAGGG - Intergenic
1118853803 14:69605782-69605804 CTGGCAGCTCAGAGCTAGCAAGG + Intergenic
1123034353 14:105465893-105465915 CTTGAATCTCAGAGCACACTTGG - Intronic
1126805784 15:52347984-52348006 CTGGTATCTCAGGACTTACATGG + Intronic
1128267635 15:66280486-66280508 CTGATATCTGAGTGCATACACGG + Intergenic
1129726209 15:77903077-77903099 CTGGGCTCCCGGAGCAAACACGG - Intergenic
1130108979 15:80949546-80949568 CTGGAATCTCAGAACTAAAAGGG - Exonic
1132105011 15:99057102-99057124 CTGGGATGTCAGGGCAAACCCGG + Intergenic
1132224348 15:100128818-100128840 GTGGTATCCCAGAGCAACCATGG + Intronic
1135157643 16:20067049-20067071 CTGCGATCACACAGCAAACATGG + Intronic
1137678747 16:50319857-50319879 CTGCTTTCCCAGAGAAAACAGGG + Intronic
1139247078 16:65455547-65455569 CTGGTATCCCAGAACACACTAGG + Intergenic
1142975565 17:3641789-3641811 CTTGCATCTCTGAGGAAACATGG + Intronic
1143168396 17:4910969-4910991 TTAGTATCTCAGAGGAAAGAAGG + Intergenic
1146650020 17:34600953-34600975 CTTCTCTCCCAGAGCAAACATGG - Intronic
1148188830 17:45664799-45664821 CTGGGATCTCAGTGCATACAAGG + Intergenic
1148877966 17:50703637-50703659 CTGGTATTCCAGAGAAAGCAAGG + Intronic
1154307418 18:13240734-13240756 CTGGAATATCAAAGTAAACAGGG - Intronic
1155281835 18:24248179-24248201 CTGCTATCTCAGAGCATATAAGG + Intronic
1156346697 18:36263520-36263542 CTGGGATCTCAGAGCCCACTTGG - Intronic
1159895679 18:73993802-73993824 CTAGTATTTGATAGCAAACAGGG - Intergenic
1160187625 18:76687885-76687907 ATTGTATCTCTGAGCAGACATGG - Intergenic
1162899934 19:13788795-13788817 CTGGGATCACAGGGCAAACCCGG - Intergenic
1166233212 19:41437993-41438015 CTGGCATCTCAAACCTAACATGG - Intronic
925820269 2:7793185-7793207 CTGGTCTCTCAGAACACACACGG - Intergenic
928413301 2:31070882-31070904 CTGGTCTCTGTTAGCAAACAGGG + Intronic
928743788 2:34387729-34387751 CTCATATCTCACAGAAAACACGG - Intergenic
929252427 2:39774029-39774051 CTGGGATGTCAGAGGAAACTGGG - Intronic
930946725 2:57084600-57084622 CTCCAATCTCAGAGCAAAAATGG - Intergenic
932893152 2:75613176-75613198 CGGGGATCTGAAAGCAAACATGG + Intergenic
937543664 2:122989207-122989229 CTGCGATCTCAGAGCAACCTGGG + Intergenic
937829742 2:126406400-126406422 ATGGTATCTCAGGGGAAAAAGGG - Intergenic
941362165 2:164564611-164564633 CTGAAATCTCAGAGAAAAAAAGG - Intronic
941731293 2:168921240-168921262 CTGGTATATAACAGCAAAGATGG - Intergenic
941774430 2:169376489-169376511 CAGGTATCTCAGTGGAAACATGG + Intergenic
942948156 2:181692071-181692093 CTGATATCTCAGTGAAAATACGG + Intergenic
943407185 2:187504322-187504344 CTGCTATCTCACAGAAAACCTGG - Intronic
943892031 2:193300282-193300304 CTGGTTTCTCAAGGCAACCACGG - Intergenic
944079833 2:195774812-195774834 GTGGCATCTCAGAGTAAAAATGG - Intronic
945340131 2:208642644-208642666 CTGGTTTCTCAGATCAGACCAGG + Intronic
945836914 2:214844842-214844864 CTGATATGTCAGATCAAATAAGG - Intergenic
946045603 2:216818438-216818460 CTGATTTCTCAGAGCAACCCAGG + Intergenic
946633873 2:221702783-221702805 CAGAGAACTCAGAGCAAACAAGG - Intergenic
946701198 2:222416100-222416122 CTGGTCTCTCAGGGCAAGGATGG - Intergenic
948779033 2:240305738-240305760 TTTGTATCTCAGTGCAAACGTGG - Intergenic
948944447 2:241212358-241212380 CTGGCACCTCTGAGCAAACAGGG + Intronic
1169776683 20:9262886-9262908 CAGGAATCTCAGAGTAAGCAGGG + Intronic
1174645622 20:52082908-52082930 CTGGTATCACCCAGCAAACTTGG - Intronic
1175885293 20:62286826-62286848 CTGTTGTCCCAGAGCAGACAGGG + Intronic
1179821032 21:43937063-43937085 CTTTTATCTTAAAGCAAACATGG - Intronic
1180639802 22:17289053-17289075 CTGCTATCTCAGAGGAAGAAGGG - Intergenic
1180783760 22:18535726-18535748 TTGGAACCTCAGAGCAGACAGGG - Intergenic
1181127329 22:20709775-20709797 TTGGAACCTCAGAGCAGACAGGG - Intronic
1181137213 22:20776630-20776652 CTGGTACTCCAGAGCGAACAAGG + Intronic
1181240661 22:21475078-21475100 TTGGAACCTCAGAGCAGACAGGG - Intergenic
1181899236 22:26139180-26139202 TTTGTACCTAAGAGCAAACAAGG + Intergenic
1183498502 22:38164022-38164044 CTGGTATCTCAGCAGAAACAGGG - Intronic
953344509 3:42164075-42164097 CGTGTATCTCAGAGCAAGCTGGG + Intronic
954013571 3:47664776-47664798 CTGGTATCTAACAGCAAGGAGGG + Intronic
954096049 3:48329165-48329187 CCAGTTTCTCAGAGCAACCATGG - Intergenic
954183444 3:48899080-48899102 ATGGGAGCTCAGAGGAAACATGG - Intergenic
954946330 3:54427845-54427867 AGGGTATCACAGAGAAAACAAGG - Intronic
956865787 3:73367276-73367298 CTGTTACTGCAGAGCAAACAAGG + Intergenic
961462764 3:127063125-127063147 CGGGGAGCTCAGAGCAAAGACGG - Intergenic
963805069 3:149714434-149714456 CTCGGATCTCAGAGCAAGGATGG + Intronic
965516279 3:169624745-169624767 CTGTTTTCCCAGACCAAACATGG + Intronic
965789711 3:172374266-172374288 GTGGTCTCTCAGAACACACAGGG + Intronic
966510630 3:180758305-180758327 CTAGTATCACAAAGCAAAGAAGG + Intronic
973150803 4:46885583-46885605 CTGGCATCTGATATCAAACATGG - Intronic
974098434 4:57390454-57390476 ATGCTATCTGAGAGCAACCATGG - Intergenic
976456708 4:85256370-85256392 CTGCTACCTCAGAGGAATCATGG - Intergenic
978562097 4:110044105-110044127 CTGCTACCTGAGACCAAACAGGG - Intergenic
978870302 4:113567595-113567617 CAGGTATCTCAAAGCAAATATGG + Intronic
979768190 4:124488953-124488975 CTGCTTTCTCTGAACAAACATGG + Intergenic
981831822 4:149010523-149010545 TTGGGATCTCAGAGCAAATGGGG + Intergenic
984477431 4:180255128-180255150 ATGGCATCTCAGAGCAATGATGG + Intergenic
986415246 5:7521685-7521707 CTGGTTTCTCAGACCCAGCAGGG - Intronic
989673787 5:43950373-43950395 CTGGTATGTCTTAGCAAAGATGG + Intergenic
990268357 5:54104991-54105013 CAGCCATCTCAGAGCAACCAAGG + Intronic
990561145 5:56984331-56984353 CAGCTATCTTAGGGCAAACAAGG - Intergenic
992952474 5:81874060-81874082 CTGCTGTCCCAGAACAAACAAGG + Intergenic
993361004 5:86976377-86976399 GTGATATCTCAGAGTAAACAGGG + Intergenic
996234491 5:121108863-121108885 TTGGGATCTCAGAGCAAAGTCGG - Intergenic
996731786 5:126724165-126724187 CTGAAATCACAGAGAAAACAAGG + Intergenic
998502004 5:142641289-142641311 CAGAAATCTCAGATCAAACAAGG - Intronic
999414899 5:151386555-151386577 ATGGTATCTCAAAGCAAAAATGG - Intergenic
999730236 5:154471710-154471732 CTTGTATCAAAGTGCAAACATGG - Intergenic
1000520228 5:162285673-162285695 CTGGTATATTTGAGCTAACATGG + Intergenic
1004218647 6:13725697-13725719 CTGGTATTTCAGATCACCCACGG - Intergenic
1004489697 6:16102995-16103017 CAGATATATCAGACCAAACAAGG - Intergenic
1005276491 6:24224728-24224750 CTGGTAGCTGAGAGCAGACTGGG - Intronic
1008694558 6:54019435-54019457 CTGGTATCTCTGAGAAAAAATGG - Intronic
1012375286 6:98554791-98554813 CTGGTATCTGGAAGCAAAAAAGG + Intergenic
1017519445 6:155188584-155188606 GTGTTATTTCAGAGCCAACAAGG + Intronic
1027604314 7:80281996-80282018 CATGTATTTCACAGCAAACAAGG - Intergenic
1029722172 7:102375517-102375539 CTGCTTTCTCAGAGCAGGCATGG + Intronic
1031120707 7:117718650-117718672 CTGAAATCTCACAGAAAACATGG - Intronic
1033813410 7:145044558-145044580 CTGGTTTCTCAGTGCAAACAAGG + Intergenic
1035407787 7:158611105-158611127 GAAGTATCTCAGTGCAAACAGGG - Intergenic
1036576523 8:10032357-10032379 CTGGTATCCCAAAGGAAACCAGG - Intergenic
1037915832 8:22772941-22772963 CTGGGCTCTCATAGCTAACAGGG + Intronic
1038469706 8:27804403-27804425 CAGGTATCTCAGAACAAGTAAGG - Exonic
1038688082 8:29737041-29737063 CTGGCATTCCAGAGCAAACCAGG + Intergenic
1039097689 8:33904245-33904267 CTGGTATCTCAGAGAAGGGAGGG + Intergenic
1039980312 8:42404312-42404334 CTGGTATCTCAGAGAATTCAGGG + Intronic
1040580945 8:48698111-48698133 CTGGTTTTTCAGAGAAAACTGGG - Intergenic
1041195923 8:55401295-55401317 CTGGTATCCCAGAGCACACAAGG + Intronic
1041395382 8:57384804-57384826 CTGGAATCCCAGAGGAAAGAGGG + Intergenic
1042343106 8:67701072-67701094 GTACTATCTCAGAGAAAACATGG + Intronic
1043932799 8:86109934-86109956 CTGTTATCTCAGGATAAACATGG + Intronic
1045016529 8:98005643-98005665 CTGCTTTCTCAGAGGAATCAGGG + Intronic
1045734967 8:105284287-105284309 CTGGTATCTTAGAGAAGAGAAGG + Intronic
1048267207 8:132998240-132998262 CTGGCCTCCCAGAGCAAAAAGGG - Intronic
1048334156 8:133490663-133490685 CTGGTATGTTACAGAAAACAGGG + Intronic
1050729612 9:8693391-8693413 CTGGGATATCAGAGAAAACATGG + Intronic
1051078121 9:13264800-13264822 CTGTTAACTCACACCAAACATGG + Intronic
1053193989 9:36100733-36100755 CTGGTATTTCAGAGGAGACAAGG - Intronic
1056005784 9:82269407-82269429 CTGCTCTCTCAAATCAAACATGG + Intergenic
1060257968 9:122049082-122049104 CTGGTATCTGAGAACAACTAGGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061360354 9:130137930-130137952 CAGATTTCTCAGAGGAAACATGG - Exonic
1188788280 X:34375926-34375948 CTGGTATTTGATAGCAAAAAAGG + Intergenic
1189115100 X:38334262-38334284 ATGGTCTCTCAGCGAAAACATGG + Intronic
1191663328 X:63672622-63672644 CTGATGTCCCAGAGCACACAGGG + Intronic
1193681355 X:84522842-84522864 CTGGTATCTCAGTGGAACAATGG + Intergenic
1193877981 X:86885373-86885395 CTAGTATTTGAGAGCAAAAAGGG + Intergenic
1193959092 X:87901382-87901404 TTGGTCTCTCAGAGCAAATGGGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1199420003 X:147634300-147634322 CTGTCATCTCAGCTCAAACAGGG + Intergenic
1199472278 X:148208537-148208559 CCAGTTTCTCAGTGCAAACATGG - Intergenic
1199984099 X:152938028-152938050 CTGAGATCTCAGACCAAAGAAGG - Intronic