ID: 1090190022

View in Genome Browser
Species Human (GRCh38)
Location 11:124761403-124761425
Sequence CCAAAGGGAAGAGGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 522}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090190022_1090190043 18 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190043 11:124761444-124761466 GTGGTGGGCCTTGGGGGGGTGGG 0: 1
1: 0
2: 2
3: 50
4: 579
1090190022_1090190041 14 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190041 11:124761440-124761462 AAGGGTGGTGGGCCTTGGGGGGG 0: 1
1: 0
2: 5
3: 39
4: 517
1090190022_1090190042 17 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190042 11:124761443-124761465 GGTGGTGGGCCTTGGGGGGGTGG 0: 1
1: 1
2: 3
3: 103
4: 1167
1090190022_1090190045 22 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190045 11:124761448-124761470 TGGGCCTTGGGGGGGTGGGGTGG 0: 1
1: 0
2: 8
3: 165
4: 1729
1090190022_1090190039 12 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190039 11:124761438-124761460 ATAAGGGTGGTGGGCCTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 207
1090190022_1090190038 11 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190038 11:124761437-124761459 AATAAGGGTGGTGGGCCTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 187
1090190022_1090190030 -5 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190030 11:124761421-124761443 TTTGGCTCTGGAAACCAATAAGG 0: 1
1: 0
2: 0
3: 11
4: 168
1090190022_1090190044 19 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190044 11:124761445-124761467 TGGTGGGCCTTGGGGGGGTGGGG 0: 1
1: 0
2: 5
3: 84
4: 740
1090190022_1090190031 -4 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190031 11:124761422-124761444 TTGGCTCTGGAAACCAATAAGGG 0: 1
1: 0
2: 2
3: 15
4: 158
1090190022_1090190032 -1 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190032 11:124761425-124761447 GCTCTGGAAACCAATAAGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 107
1090190022_1090190033 2 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190033 11:124761428-124761450 CTGGAAACCAATAAGGGTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 212
1090190022_1090190037 10 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190037 11:124761436-124761458 CAATAAGGGTGGTGGGCCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 91
1090190022_1090190036 9 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190036 11:124761435-124761457 CCAATAAGGGTGGTGGGCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 131
1090190022_1090190040 13 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190040 11:124761439-124761461 TAAGGGTGGTGGGCCTTGGGGGG 0: 1
1: 0
2: 1
3: 24
4: 217
1090190022_1090190034 3 Left 1090190022 11:124761403-124761425 CCAATTTCCCCTCTTCCCTTTGG 0: 1
1: 0
2: 5
3: 49
4: 522
Right 1090190034 11:124761429-124761451 TGGAAACCAATAAGGGTGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090190022 Original CRISPR CCAAAGGGAAGAGGGGAAAT TGG (reversed) Intronic
900434292 1:2620937-2620959 CCAATGGGAAGAGGGTATAATGG - Intronic
900785816 1:4649822-4649844 TTTAAGGGAAGGGGGGAAATGGG - Intergenic
901196978 1:7445633-7445655 CCAGAGAGAAGAGGGGACACAGG + Intronic
901489607 1:9589804-9589826 CCAGAGGGCAGGGGGGAAAGTGG + Intronic
902253041 1:15168344-15168366 CCAAAAGAAAGAAGGGGAATGGG + Intronic
902803529 1:18846400-18846422 CCACAGGGAACAGGGAAAGTTGG - Intronic
903684442 1:25120510-25120532 GCAGAAGGAGGAGGGGAAATTGG - Intergenic
904648596 1:31987332-31987354 CCAAGGGGAAGAGAGGCACTTGG + Intergenic
905089315 1:35415335-35415357 GCATAAGGAAGAGGGGAAAGAGG + Intronic
905109953 1:35587935-35587957 CGAATGGGAAGAGGGGATTTGGG + Intronic
905353957 1:37367883-37367905 CCAAATGGAAGAGTTGAACTGGG - Intergenic
905372373 1:37490171-37490193 CCAAGGGGAAGAGGGCACACAGG - Intergenic
905375223 1:37515367-37515389 CCAAAGGGCACTGGGAAAATGGG - Intergenic
905529693 1:38667787-38667809 CCATAGGGCACAGGGGAAAGGGG + Intergenic
906253082 1:44326326-44326348 CCACAGGGAAGAGGGTAAGTTGG + Intronic
906350678 1:45056215-45056237 TCAAAGGGGAGAAGAGAAATGGG + Intronic
906420297 1:45660390-45660412 CAAAAGGGGAAAGGGGAAAAGGG + Exonic
906806643 1:48785511-48785533 GCTAAGGGAAAATGGGAAATAGG - Intronic
907097535 1:51795421-51795443 ACAAAGGGAAGAGAAGAAATAGG - Intronic
907315905 1:53572483-53572505 CCAAAGGGAGGTGGGCAAACAGG - Intronic
907554631 1:55333706-55333728 ACAAAGGGAAGACAGGAAATGGG + Intergenic
907582283 1:55583117-55583139 CCTAAGGGAAAAAGGGAAAGGGG + Intergenic
907787361 1:57625731-57625753 GGAAAGGGAGGAGGGGAAAAAGG + Intronic
907898658 1:58717555-58717577 CCCAAGGAAAAAGGGGAAAGGGG - Intergenic
908121474 1:60990184-60990206 CCTAAGGGAAGAGGGGCTGTTGG - Intronic
908533661 1:65057281-65057303 CTACAGGGAAGAGGGATAATTGG + Intergenic
909358887 1:74739924-74739946 CCAGAGGGAGGAGGAGAAAGAGG + Intronic
910277159 1:85462161-85462183 TAAAAGGGAAGAGAGGAAAGAGG + Intronic
911581301 1:99636400-99636422 CCAAAAGGAAGAGGAGAAGAGGG + Intergenic
912005596 1:104896109-104896131 CCAGTGGGAAAAGGGGGAATGGG + Intergenic
912108032 1:106305266-106305288 CCAAAGAGAAGAGGTTATATTGG + Intergenic
912278817 1:108290736-108290758 CTAAAGGAAAGAGAGAAAATAGG - Intergenic
912289409 1:108403621-108403643 CTAAAGGAAAGAGAGAAAATAGG + Intronic
912459114 1:109819456-109819478 CCACAGGGAAGATGGGAGACAGG - Intergenic
913532450 1:119742656-119742678 CCAGAAGGGAGAGGGCAAATGGG - Intronic
914431213 1:147621272-147621294 TTAAAAGGAAGAGGGGAAATGGG + Intronic
914788243 1:150852901-150852923 CCAAATGGAAGAATGGAAAGAGG + Intronic
914989011 1:152482292-152482314 TAAAAGGGAAAAGGGCAAATGGG - Intergenic
915599389 1:156913056-156913078 CCAAAGGGAAGATGAGGAGTGGG + Intronic
916206693 1:162321903-162321925 CAAAAGGGAAGAGGGAGAAGGGG + Intronic
916237086 1:162601005-162601027 GAAAAGGGAAGAATGGAAATGGG + Intergenic
916836876 1:168554816-168554838 ATAAAGGAAAGAGGGGAGATGGG + Intergenic
917249300 1:173040153-173040175 GCAAAGTGAAGAGGGGAATTTGG + Exonic
917508111 1:175647499-175647521 GTAAAGGGAAGAGGGGAAGCTGG + Intronic
917709334 1:177668842-177668864 CCAAAGGGAAGGAGGGAAGCTGG - Intergenic
918812661 1:189140601-189140623 GCAAAGGGGAGAGGGGAGAGGGG + Intergenic
918812887 1:189142795-189142817 CCGAAGGGAAGAGTGGGAAGGGG - Intergenic
919667408 1:200305208-200305230 CTAATAGGAAGAGGGGGAATAGG + Intergenic
919770023 1:201152140-201152162 GGAGAGGGATGAGGGGAAATGGG + Intronic
920110236 1:203582448-203582470 CCCTAGGGAAGAGGGGGAACAGG + Intergenic
920601875 1:207333932-207333954 CAAAAAGGAAGAGGGGAAGGAGG + Intronic
920746904 1:208637615-208637637 CCATAGGGGAGAAGGGAAGTGGG - Intergenic
921141021 1:212306316-212306338 ACAAAGGCAAGAAGGGAAAAGGG + Intronic
921815191 1:219555539-219555561 CCAAAGGGAGGAGAGGAATTTGG + Intergenic
921901260 1:220453472-220453494 CCACAGGGAAGAAGGGGAAAAGG - Intergenic
922578451 1:226679262-226679284 GAAAAGGGAAGAGGGGAGACAGG - Intronic
922969941 1:229727762-229727784 CCAGACGGAGGAGGGGAAAGGGG + Intergenic
923327558 1:232894216-232894238 GCAAAGGGAAGAGTGGATACTGG + Intergenic
923657480 1:235930688-235930710 CCAAAGGGAGGAGGGTAAATGGG + Intergenic
924172850 1:241359033-241359055 ATAAAGGGAAGAAGGAAAATAGG - Intergenic
924615569 1:245609150-245609172 GCACAGGGAAGGGGGGAAAAGGG - Intronic
1063231809 10:4072694-4072716 TCAAATGGCACAGGGGAAATGGG - Intergenic
1064201339 10:13287611-13287633 CCATAGGGAAGAGTCGATATAGG - Intronic
1064292763 10:14050842-14050864 CCAAATGGAAGAGGTGCACTGGG - Intronic
1065122900 10:22545387-22545409 CCAAAGGGCAGAGAGGGAAGGGG + Intronic
1065668287 10:28086402-28086424 CCAAAGGCCAAAGGGGAAACAGG + Intronic
1065675721 10:28171866-28171888 CCAAAGAGAAGAGGGGAGGATGG + Intronic
1066463513 10:35633305-35633327 ACAAAGGAAAGAGGAGTAATTGG + Intergenic
1067268374 10:44767275-44767297 CCAAATGAAAGAGCAGAAATAGG - Intergenic
1068128767 10:52871667-52871689 CCAGAGGACAGAGGAGAAATGGG - Intergenic
1069136679 10:64775636-64775658 CCAATGAGAAGAGGGGAAGGAGG - Intergenic
1069408941 10:68132693-68132715 CCAAATGGTAGGGGGGATATAGG + Intronic
1071552537 10:86578051-86578073 GCAAAGAGAAAAGGAGAAATTGG - Intergenic
1072044692 10:91643292-91643314 CCACAAGGAAAAGGGGAAGTGGG - Intergenic
1072465674 10:95660197-95660219 CCAAAGGCAGGAGGTAAAATTGG + Intergenic
1072867467 10:99079266-99079288 CCAGAGGGAAGCTGGGAACTAGG + Intronic
1073641392 10:105255809-105255831 CCACTGGGAACTGGGGAAATGGG + Intronic
1073983080 10:109177199-109177221 ACAAATGGAAGAGGTGTAATGGG + Intergenic
1075323704 10:121512829-121512851 ACACAGGGAAGAGAGGAAAAAGG + Intronic
1075947794 10:126453346-126453368 CCAAAGTGAAGAAGGGAAGAAGG + Intronic
1076934258 10:133556834-133556856 CCACAGGCATGAGGGGATATGGG + Intronic
1077363266 11:2150489-2150511 CCCATGGGAGGAGGGAAAATGGG + Intronic
1077486165 11:2839247-2839269 TCCAAGGGAAGAGGGCAAAGGGG + Intronic
1077759157 11:5072069-5072091 CCTCAGGGAAGAGGAGAAACAGG + Intergenic
1078393040 11:10952935-10952957 CCAAATGGGAGAGAGGAAAAAGG - Intergenic
1078554419 11:12309305-12309327 CTAAAGGGAAGCTGGGTAATGGG - Intronic
1078870740 11:15342309-15342331 CCAAAGGGAAGGCGGGAAGTGGG - Intergenic
1079566412 11:21888357-21888379 CCACATGGAAGAGGTGAGATGGG + Intergenic
1080673709 11:34405415-34405437 GAAAAGAGAAGTGGGGAAATAGG - Intergenic
1080770927 11:35340690-35340712 CCAAAGGGGAGGGGGGAACCAGG - Intronic
1080862748 11:36164014-36164036 CCAGTGGGAAGAGAGGAAATCGG + Intronic
1081202053 11:40228464-40228486 CCTAAGGGAAGGGAGGAAACAGG + Intronic
1081250361 11:40824159-40824181 CAAAAGGGATGAGGGAAATTTGG + Intronic
1081407920 11:42719347-42719369 CGAAAGGGCAGTGGGGAGATAGG + Intergenic
1081795734 11:45818108-45818130 CCATGGGGAAGAGTGGAAAGAGG + Intergenic
1082217830 11:49596179-49596201 CCAAGGAAAAGAGGGCAAATGGG + Intergenic
1083662027 11:64255891-64255913 TCAATGGGGAGAGGGGAAACTGG + Intronic
1083670351 11:64296755-64296777 CCAAAGGGAAGGGGAGAACAGGG + Intronic
1083859590 11:65412714-65412736 CCAAAGGGAGGAGGGTGAACAGG - Exonic
1084156185 11:67314002-67314024 TCAAAGTGAAGAGGGGTACTTGG - Intergenic
1084201228 11:67559907-67559929 CCTAAGGGAAGACTGGAGATAGG + Intergenic
1084672222 11:70614059-70614081 CCAACCAGAAGAGGGGAATTTGG + Intronic
1086070975 11:82798649-82798671 CAAAAAGGAAGAAGAGAAATCGG + Intergenic
1086631740 11:89027970-89027992 CCAAGGAAAAGAGGGCAAATGGG - Intronic
1086726731 11:90195389-90195411 CCAAATACAAGAGAGGAAATGGG - Intergenic
1087037062 11:93766361-93766383 CCAGAGGGAAAAGGGCAGATTGG + Intronic
1087275901 11:96160268-96160290 TCCAAGGGAAGAGACGAAATAGG - Intronic
1087293103 11:96340919-96340941 TCAAAAGGGAGAGGGGAAATGGG + Intronic
1087663334 11:101013315-101013337 CTAAAGAGAGGGGGGGAAATGGG + Intergenic
1089357742 11:117866130-117866152 GCACCGGGAAGGGGGGAAATGGG + Intronic
1090190022 11:124761403-124761425 CCAAAGGGAAGAGGGGAAATTGG - Intronic
1090430740 11:126644303-126644325 ACCAAGGGAAGTGGGAAAATAGG + Intronic
1090439592 11:126714606-126714628 CCAAGGAGAAGTGAGGAAATTGG - Intronic
1091400207 12:176721-176743 CCACAGGGGAGAGGGCAAATTGG - Exonic
1091827351 12:3522829-3522851 ACAAAGGGAAAAGGGTAAATGGG + Intronic
1092244532 12:6856239-6856261 CCAAGGGGAAGAGGGGCATGTGG + Intronic
1092276558 12:7065759-7065781 CTAAAGGGAAGAGGTAAAATTGG - Intronic
1092310795 12:7349938-7349960 GCAAAGGGAAGAGGGGGTATGGG - Intronic
1093408610 12:18838243-18838265 GCAAAGGGATGAGGGTCAATAGG - Intergenic
1094033686 12:26043357-26043379 CATAAGGGTAGAGGGGAACTGGG + Intronic
1094335264 12:29343294-29343316 GCAAAAGGAAGGGGAGAAATAGG + Intronic
1095572710 12:43700967-43700989 CAAAAGGGAAAAGAGAAAATAGG + Intergenic
1095585300 12:43843173-43843195 AGAAAGGGAAGAGGGGGAAGAGG - Intronic
1095640171 12:44478130-44478152 CTGAAAGGAAAAGGGGAAATAGG + Intergenic
1096845762 12:54405598-54405620 CAAGAGGGAAGAGTGGGAATGGG - Intronic
1097269126 12:57763678-57763700 CCAAAGGGAAGAGATGCAAATGG + Exonic
1097287560 12:57889504-57889526 CCAGAGGGAAGCAGGGAAACAGG + Intergenic
1098055179 12:66497502-66497524 TCAAAGGGAAGAGAGCAACTGGG + Intronic
1098227652 12:68341116-68341138 CCAAAGGAAGGATGGGAATTGGG + Intergenic
1098661615 12:73101432-73101454 CCAAAGGGAAAAGGGGTTAATGG - Intergenic
1098699261 12:73603755-73603777 ACAAAGGAAAGAGGAGAAAAAGG - Intergenic
1100379093 12:94045086-94045108 CCAAGGGGAAGAGTGGACAGAGG - Intergenic
1100673482 12:96841563-96841585 CCAAAGTCAACAAGGGAAATGGG - Intronic
1101091715 12:101293856-101293878 CCAAAGGGAACACGGGAGAAAGG - Intronic
1101723497 12:107371008-107371030 CCAAAGGGAGGAGGAGAAGGGGG - Intronic
1102208711 12:111108687-111108709 GCAAAGAGAAGGGGGAAAATGGG - Intronic
1102370195 12:112376627-112376649 CTAAAGGGGAGAGGAGAGATGGG - Intronic
1102943604 12:116965211-116965233 CCAAAGGGAATAGTGAAAAGGGG + Intronic
1104090403 12:125512023-125512045 ACAAGGGTAAGAGTGGAAATAGG + Intronic
1105765218 13:23552642-23552664 CCAAAGGGAAAAGTGAAGATTGG - Intergenic
1105820894 13:24079816-24079838 CAAAAGGTGAGAGGCGAAATGGG - Intronic
1106412176 13:29518144-29518166 CAAAAGGGAAGGAGAGAAATAGG + Intronic
1106657429 13:31760853-31760875 CCAAAAGGAAGAGGAAAATTTGG + Intronic
1108046548 13:46388909-46388931 CCCAAGGGAAGCAGGGTAATTGG - Intronic
1108196957 13:48004445-48004467 CCAAATGGCAGAGGGTGAATGGG - Intergenic
1110236113 13:73219836-73219858 CATAAGGGAGAAGGGGAAATGGG - Intergenic
1112289045 13:98128815-98128837 CCAAAAGGAAGAGGTTTAATTGG - Intergenic
1112527025 13:100159700-100159722 TAAAAGGGAAATGGGGAAATAGG - Intronic
1112851884 13:103716124-103716146 GCAAAGAGCAGAGTGGAAATGGG + Intergenic
1112897957 13:104324195-104324217 CCAAATAGAAGAGAAGAAATCGG - Intergenic
1113090194 13:106610024-106610046 GCAAATGGAAGCAGGGAAATGGG - Intergenic
1113176934 13:107575618-107575640 GCAAAGGGAGTGGGGGAAATGGG - Intronic
1114233489 14:20804006-20804028 CCAAAGATAACAGGGGAAAGTGG - Intergenic
1116151307 14:41145502-41145524 CCAAAGTGCAGAGGGGACCTAGG + Intergenic
1117715062 14:58571971-58571993 GGGAAGGGAAGAGAGGAAATTGG + Intergenic
1118150028 14:63179373-63179395 CCAAAGGAAGGAGGAGAAAAAGG - Intergenic
1118684134 14:68274012-68274034 GCAAAGGAGAGTGGGGAAATTGG - Intronic
1119630211 14:76224225-76224247 CCAATGGGAAAAGGGGAATGGGG + Intronic
1119754473 14:77105319-77105341 CCAGAGGGGAGAGGGGACAGGGG - Intronic
1120252156 14:82070930-82070952 CCAAAGGGAAGGTGGACAATAGG - Intergenic
1120295923 14:82640745-82640767 TCATAGGGGAGAGGGGAGATGGG + Intergenic
1120372536 14:83654777-83654799 TCGTAGGCAAGAGGGGAAATTGG + Intergenic
1120433197 14:84445253-84445275 GAAAAGTGAAGAGAGGAAATGGG + Intergenic
1121838226 14:97110754-97110776 CTTAAGAGAAGAGGGGAATTTGG - Intergenic
1122064742 14:99164953-99164975 GCAAAGGGAAGAGGGAAAAGTGG + Intergenic
1123101998 14:105810247-105810269 CCAAAGGGAAGCAAGGAAAAAGG - Intergenic
1123192949 14:106588841-106588863 CCTAAGGGAAGATGGGAGGTGGG - Intergenic
1123781438 15:23632817-23632839 CAAGTGGGAAGAGTGGAAATGGG + Intergenic
1124410813 15:29435074-29435096 TGATAGGGAAGAGGGGAAAATGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124983752 15:34585257-34585279 ACAGAGGGCAGAGTGGAAATGGG + Intronic
1125250205 15:37692809-37692831 AGAAAGGGAAGACAGGAAATAGG + Intergenic
1125692287 15:41605949-41605971 GGAAAAGGAAGAGCGGAAATTGG - Intergenic
1127092095 15:55477475-55477497 CCAAAGGGAGGAGTAGAAAATGG + Intronic
1127295330 15:57604165-57604187 CCAATGGAAGTAGGGGAAATGGG + Intronic
1127697702 15:61467918-61467940 CCATACGGAAAGGGGGAAATAGG + Intergenic
1128040847 15:64572122-64572144 GCAAAGGCCTGAGGGGAAATGGG + Intronic
1128480483 15:68033345-68033367 ACAGAGGGAAGAGGAGAAAAAGG + Intergenic
1128612187 15:69083154-69083176 GCAACAGGAAGAGGGGAGATGGG + Intergenic
1129331479 15:74830107-74830129 CTGAAGGGAAGAGGGGAAGAGGG - Intronic
1129799920 15:78406010-78406032 CCAAAGTCCAGAGGGGAAAAAGG - Intergenic
1130214934 15:81959345-81959367 GTAAAGGGAAGAGGAGAAAGTGG - Intergenic
1130238197 15:82159069-82159091 CCCAAGGGAAGACGGAAAGTGGG + Intronic
1130700140 15:86170397-86170419 CCACTGGGGAGAGGAGAAATAGG + Intronic
1130712007 15:86292600-86292622 TCAAAGGGCAGAGGGCAAAGTGG + Intronic
1130985815 15:88843700-88843722 CTAGAGGGAAGAGGGGATCTTGG + Intronic
1131137272 15:89947263-89947285 CCATGAGAAAGAGGGGAAATTGG - Intergenic
1132906469 16:2285182-2285204 GCAAGGGGACGAGGGGAAACTGG - Intronic
1133000553 16:2849336-2849358 GCAAAGAGAAGAGTTGAAATAGG + Intergenic
1134391034 16:13820360-13820382 AAAAAGGGAACAGAGGAAATTGG - Intergenic
1135066364 16:19313591-19313613 CCAAAGCAGAGAGGGGAAAGAGG + Intronic
1135143952 16:19945405-19945427 CCAAAGGGCAGAGGTCAAATAGG + Intergenic
1135343337 16:21667029-21667051 CCAAAGGGAAGGGAGAAAAAAGG + Intergenic
1135680370 16:24451249-24451271 CCAAATGGAAGAGGGTCATTGGG + Intergenic
1135829890 16:25763711-25763733 CCAAAAGCAAGAGGGGCAAGAGG + Intronic
1136054495 16:27678404-27678426 GGAGAGGGAAGAGGGGAGATGGG - Intronic
1138116287 16:54363033-54363055 GCAAGGGGAAGAGGGGACAGCGG - Intergenic
1138520082 16:57566066-57566088 CCAAAGGGAGAAGGGGAGGTGGG - Intronic
1138527594 16:57617999-57618021 CCATGGGGAAGAGGGGCAAGAGG + Intronic
1138994898 16:62438613-62438635 CCAAATGGGAAATGGGAAATGGG + Intergenic
1142676971 17:1519685-1519707 CCAAAGGGAAGAGGAGGAGCAGG + Exonic
1143116283 17:4583654-4583676 GAAAAGGGAAGAAGGGAAACAGG - Intergenic
1144113497 17:12062887-12062909 GAAAAGGGAAGAGGGGAGGTGGG - Intronic
1144408350 17:14974590-14974612 CCAAAGGGAAGAGGGGGCAGGGG - Intergenic
1144878526 17:18417416-18417438 CAAAAGGGAAGAAGGGAGTTTGG + Intergenic
1144885227 17:18453824-18453846 CAAAAGGGAAGAAGGGAGTTTGG - Intergenic
1144967523 17:19087432-19087454 CAGCAGGGAAGAGGGGAATTGGG - Intergenic
1144980396 17:19164633-19164655 CAGCAGGGAAGAGGGGAATTGGG + Intergenic
1144987826 17:19213599-19213621 CAGCAGGGAAGAGGGGAATTGGG - Intergenic
1145146991 17:20490553-20490575 CAAAAGGGAAGAAGGGAGTTTGG + Intergenic
1145153709 17:20526971-20526993 CAAAAGGGAAGAAGGGAGTTTGG - Intergenic
1145177058 17:20709645-20709667 CAAAAGGGAAGAAGGGAGTTTGG + Intergenic
1145843528 17:28017353-28017375 CCAAAGGGAACAGTTGAGATGGG + Intergenic
1146640515 17:34537217-34537239 CCAAAGGGAAGAGGAGGGAAGGG + Intergenic
1148258962 17:46162551-46162573 CAAAAGGGAAGAGGTGCCATGGG - Intronic
1148507084 17:48135987-48136009 ACAAAGGGAAGAATGGATATTGG - Intronic
1148813980 17:50313424-50313446 CCAACTGGAAGGTGGGAAATGGG + Intergenic
1149670460 17:58403697-58403719 CAACTGGGAAGAGTGGAAATGGG - Intronic
1149981403 17:61314255-61314277 GCAAAGGGAAGAGGTGCAAATGG - Intronic
1150188895 17:63216372-63216394 CCAAATGGAAGAGGGGCAGAGGG - Intronic
1150867964 17:68874521-68874543 CCACAGGGAATAAGCGAAATAGG - Intronic
1151095429 17:71492203-71492225 CTACAGGGAAGAGGTGACATTGG + Intergenic
1151412580 17:73941062-73941084 ACAATGGGAAGAGGGGGAAAGGG + Intergenic
1152583519 17:81179278-81179300 CCCAGGGGAGGTGGGGAAATGGG + Intergenic
1153417760 18:4868071-4868093 CCAAAAAGATGAGAGGAAATGGG + Intergenic
1153563920 18:6400226-6400248 GCAAAGGAAAGGGAGGAAATTGG - Intronic
1153625123 18:7016042-7016064 GCTGAGGGAAGCGGGGAAATGGG + Intronic
1153642045 18:7165688-7165710 CCAATGGGAAGAAGGGAGAGGGG + Intergenic
1154141925 18:11831707-11831729 CCAGAGGGAGCAGGGGAGATGGG + Intronic
1156450721 18:37264928-37264950 GCAAGGTGAAGAGTGGAAATGGG + Intronic
1156748707 18:40423891-40423913 CCAAAGAGAAGAGTGGAGAGTGG + Intergenic
1156839409 18:41594028-41594050 CCAAAGAGAAGAGAGGAGAAAGG + Intergenic
1156936359 18:42713739-42713761 ACAAAGAGAAGAGGGTAAATAGG - Intergenic
1158982092 18:62773054-62773076 CCAAAGGGAAGAGATGAATGTGG + Intronic
1160218385 18:76954050-76954072 CCCAAAGGAGAAGGGGAAATCGG - Intronic
1160917725 19:1505464-1505486 GCCAGGGGAAAAGGGGAAATTGG + Exonic
1161482556 19:4518204-4518226 GCAAGGTAAAGAGGGGAAATGGG - Intergenic
1161854278 19:6754508-6754530 CCCCAGGGAAGAAGGGAGATGGG - Intronic
1162187928 19:8921844-8921866 CCAGGGGGAAGAGGGGACAGGGG - Intronic
1163398262 19:17076411-17076433 CTATTGGGAAGCGGGGAAATGGG + Intronic
1164187581 19:22884210-22884232 CAAAAGGGAAGAAAGGAGATAGG + Intergenic
1164794461 19:31014839-31014861 AGAAAGGGAAAAGGGGAAAAAGG + Intergenic
1165125781 19:33596111-33596133 CCATAGGAAAGAGGGGATGTAGG - Intergenic
1165144481 19:33722610-33722632 CCCCAGGGAAGAGGGGGAAGGGG - Intronic
1165606299 19:37107598-37107620 CCAAAAGAAAAGGGGGAAATGGG - Intronic
1166001946 19:39882774-39882796 CCAAAGGGCAGGGGAGAGATTGG - Intronic
1166330931 19:42077596-42077618 TCAATGGGAAGAGGGGATCTGGG + Intronic
1168076661 19:53983987-53984009 ACAAAGGGAAGACAGGAACTCGG + Exonic
925047019 2:780292-780314 CCACTGGGAAAAGGGGAAAAAGG - Intergenic
925433099 2:3814130-3814152 CCAAAAGGAGGTGGGGAAAATGG - Intronic
925472133 2:4174274-4174296 CAAAAGGGAAAAGAGAAAATAGG - Intergenic
925511257 2:4627832-4627854 CCAAGAGGAAGAGGGAAAAGAGG + Intergenic
925976761 2:9147104-9147126 CCTTTGGGAAGAAGGGAAATGGG - Intergenic
926292587 2:11542478-11542500 ACGAGGGGAAGAGGGGAGATGGG + Intronic
928753781 2:34500152-34500174 CCACAGAGAAGATGGGAAATTGG + Intergenic
928986759 2:37189757-37189779 CCAAAGGAAAAAGGGGAGAGTGG - Intronic
929263750 2:39895383-39895405 CCAAATTGAAGAGGTGCAATGGG + Intergenic
929345499 2:40878753-40878775 CCAAAGGCAGAAGGGCAAATGGG - Intergenic
929819908 2:45264560-45264582 CCAAAGGGAAGAGTTAAACTTGG + Intergenic
929919836 2:46164125-46164147 ACAGAGGGAAGAGGGAAAACTGG + Intronic
930097732 2:47579579-47579601 CCTGAGAGAAGAGGGGAGATTGG - Intergenic
930737636 2:54795516-54795538 GAAAAGGGAAGAGGGGAAGGAGG + Intronic
931190042 2:59991414-59991436 CTAAAGAGAAGAGGGGACAAAGG + Intergenic
931218400 2:60266965-60266987 GCAAAGAGAACATGGGAAATGGG + Intergenic
931897123 2:66744631-66744653 CAAAAGGGAAAAGGAGAAAGAGG + Intergenic
931937902 2:67218727-67218749 CCAGAGGGCAGAAGAGAAATGGG - Intergenic
932113678 2:69025092-69025114 CCAAAGGCAAGAGAGGGCATGGG - Intronic
932605456 2:73162876-73162898 AGAGAGGGAAGAAGGGAAATGGG + Intergenic
932859497 2:75274945-75274967 CTAAAGGAAAAAGGAGAAATGGG - Intergenic
933700261 2:85250072-85250094 AGAAAGAGAAGTGGGGAAATGGG + Intronic
935850430 2:107213176-107213198 TCATAGGGGAGAGGGGAGATGGG + Intergenic
935999438 2:108811759-108811781 CAAAAGGGAAGAGGGGAGAGGGG - Intronic
936168278 2:110143389-110143411 CCAAAGGTCAGTAGGGAAATGGG - Intronic
938635836 2:133225473-133225495 CCAAAGGGAAGAGTTGAAGGAGG + Intronic
938945702 2:136210303-136210325 ATAAAGGGAAGAGGGCAAAAAGG - Intergenic
939680469 2:145125018-145125040 AGAAATGGAAGAGGAGAAATAGG + Intergenic
939808600 2:146805168-146805190 GAAAAGGGAAGAGGGAAAAGTGG + Intergenic
940280295 2:151981529-151981551 TCTATGGGAAGAGGGGATATTGG + Intronic
940462687 2:153987034-153987056 CCAAAGAGAAGAGAGGAAGGTGG + Intronic
942500192 2:176580896-176580918 CCAATGGGAATAGGGGACATGGG + Intergenic
943597523 2:189876000-189876022 CAAAAGGCAAGAGGGAAGATAGG + Intronic
944142777 2:196475355-196475377 GCAAAGGGAAGAGGGGAGATAGG + Intronic
944329145 2:198445109-198445131 GGAAAGGGAAAAGGGGAAAGGGG - Intronic
944376995 2:199057106-199057128 CCAAAGGAAATAAGGGAAAAGGG + Intergenic
944750556 2:202704946-202704968 CCTAGGGGAAGATTGGAAATGGG + Intronic
944843765 2:203648465-203648487 GCAAAGGGAAGAGAGGGAAGTGG - Intergenic
944948061 2:204713556-204713578 CTGATGGGAAGAGGGGAAACAGG - Intronic
945638671 2:212393911-212393933 CCAACTGGCAGAGGGGAAATGGG - Intronic
945962442 2:216149674-216149696 TCAAAGGGAAGAGCAGAAAATGG - Intronic
946394916 2:219438652-219438674 CTAAAGGGCAGAGGGGAAGCAGG + Intronic
946504297 2:220282482-220282504 CCAATGGCAAGAGGGAAAGTTGG + Intergenic
946988238 2:225299193-225299215 CCAAATGGAAGCTGGGAAGTTGG - Intergenic
947351015 2:229245197-229245219 CCAAAGGGAACACAGGAAAAAGG - Intronic
947892557 2:233637982-233638004 CAAAAGGAAAGAGTGGAAAATGG - Intronic
948186480 2:236025503-236025525 CCACACAGAAGAAGGGAAATTGG + Intronic
948187943 2:236035938-236035960 GCAATGGGAAGAGAGGAACTTGG - Intronic
948572755 2:238927730-238927752 CCAGAGGGTACAGGGGAGATGGG + Intergenic
948711749 2:239829446-239829468 CCAAAGGGAAGTGGAGAAAACGG + Intergenic
1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG + Intronic
1169000335 20:2163639-2163661 GCAAGGGGAAGAAGGGAAGTCGG + Intronic
1169051450 20:2582030-2582052 GAGAAGGGAAGAAGGGAAATAGG + Intronic
1169650699 20:7864066-7864088 CAAAAGGGAGGAGGGAAAAAGGG + Intergenic
1169687926 20:8297525-8297547 CAAAAGGGAAGTGGAGAAAATGG + Intronic
1171840267 20:30201902-30201924 CAAAAGGAAACAGGGGAAAATGG - Intergenic
1172063839 20:32206216-32206238 ACAGTGAGAAGAGGGGAAATGGG + Intronic
1172362154 20:34320584-34320606 CCAAATGGGAGATGGGAGATGGG + Intergenic
1172399067 20:34633533-34633555 CAAAGGGGAAAAGGGGATATTGG + Intronic
1172984840 20:38976750-38976772 GCAGAGGGAAGAGGGGAACAGGG - Intronic
1173013904 20:39208059-39208081 CCATAGGGAAGAGGTGAGCTTGG + Intergenic
1173676318 20:44838828-44838850 CAAAAGGTAAGATGGGAAATGGG + Intergenic
1174272198 20:49377847-49377869 CCAAAGGGAAGGGGTCACATGGG - Intronic
1174946451 20:54991539-54991561 ACAAAGGAGAGAAGGGAAATGGG - Intergenic
1175250831 20:57609352-57609374 CCAACAGGAAGAGGGGAGAGGGG - Intronic
1175457494 20:59126552-59126574 ACAAAGGGAAGCAGGAAAATAGG - Intergenic
1176272094 20:64240579-64240601 CCAAAGGGATGGCTGGAAATTGG + Exonic
1177332395 21:19680719-19680741 CAAAAGGGAAAAGAGAAAATGGG + Intergenic
1178351570 21:31875286-31875308 CCAAGACAAAGAGGGGAAATGGG - Intronic
1178794479 21:35731229-35731251 CCAAAGGGAAAAGTGGAGCTAGG - Intronic
1178836079 21:36098688-36098710 CAAAAGGGAAAAGAGAAAATAGG + Intergenic
1179146915 21:38776036-38776058 CCTCAGGGAAAAGGAGAAATGGG - Intergenic
1179179820 21:39035807-39035829 CCAATTGGAAGAGGGGAAGGAGG - Intergenic
1180135799 21:45861054-45861076 CCAGAGGCAGGAGGGGAACTGGG - Intronic
1180580607 22:16832488-16832510 TCAAAGAGAAAAAGGGAAATTGG + Intergenic
1181286857 22:21758708-21758730 CCAAGGGGAAGAGGTGCAGTGGG - Exonic
1182501715 22:30752953-30752975 CCAAAGGGAGGAGGGTACAGAGG + Intronic
1182523976 22:30904087-30904109 CCAAAGGGAAGACTGGGATTTGG - Intronic
1182607643 22:31519007-31519029 ACAAAGGGAAGAGGGGCACAGGG - Intronic
1182659108 22:31912583-31912605 CCATGGGGATGAGGGGAGATGGG + Intergenic
1182778090 22:32845835-32845857 CCACAGGGAACAAGGGAAGTGGG - Intronic
1183648139 22:39138569-39138591 CCAAGGGGCAGAGGGGGACTTGG + Intronic
1183831639 22:40421218-40421240 CCACAGGGAAGAGTGGAAATGGG - Intronic
1184231989 22:43163275-43163297 CCACAGGGAAGAGGGGGAGCTGG + Intergenic
1184264759 22:43341196-43341218 CCCAGGGGAAGAGTGGAAAGGGG + Intronic
1184635476 22:45825305-45825327 ATAAAGGGAAGAGGGAAAAAGGG - Intronic
1184799628 22:46751752-46751774 CCTGAGGGAAGTGGGGAGATAGG - Intergenic
1185213237 22:49583818-49583840 CCAAAAGAAAGAGAAGAAATGGG + Intronic
949343666 3:3056052-3056074 TCAAAGGGAAGAGGGGCCACGGG - Intronic
950640357 3:14344543-14344565 TGAAAGGGAGGAGGGGACATGGG + Intergenic
951040756 3:17986726-17986748 CCAAAGGGAAGATGAAAAAAAGG + Intronic
951043677 3:18015312-18015334 CAAAAAGGAAGAAGGGAGATGGG - Intronic
952719643 3:36519033-36519055 CCAGAAGGAAGAGGGGTCATGGG + Intronic
952799989 3:37281429-37281451 CCCAAGAAAAGAGGGGAATTGGG - Intronic
952937956 3:38415429-38415451 CCAAATGGAAGTGGGGATAAGGG + Intronic
953151789 3:40331669-40331691 CCCAAGGGAATAGGAGGAATGGG + Intergenic
953451070 3:43006762-43006784 CCAAAGAGAAGCAGGGAAACAGG + Intronic
954845489 3:53552044-53552066 CCAGAGGGAAGAGGGGGCCTGGG - Intronic
955893487 3:63674962-63674984 TGATAGGGAAGTGGGGAAATAGG - Intronic
955985448 3:64569019-64569041 CCACTGGGAAGAGGTGAAAAAGG + Intronic
956904613 3:73752939-73752961 CCAAATGGAAGAGGCCAAATTGG - Intergenic
958622434 3:96578439-96578461 CCAAAAGGAAAAGGGGAAAAAGG + Intergenic
959023685 3:101216157-101216179 AGAAAGAGAAGAGGGGAAATAGG - Intergenic
959461334 3:106629524-106629546 GGAAAGGGAGGAGAGGAAATGGG + Intergenic
960029550 3:113043415-113043437 ACACAGGGAAGAGGGGAGAATGG + Intergenic
961901610 3:130218300-130218322 AAAAAGGAAATAGGGGAAATCGG + Intergenic
961966026 3:130903685-130903707 GGAAAGGGGAAAGGGGAAATGGG - Intronic
962374903 3:134851370-134851392 GCAAAGAGGAGAGGGGAGATGGG - Intronic
963225553 3:142858159-142858181 CCAAAGGGGAGAGGGAACAGTGG - Intronic
963831397 3:150013238-150013260 CCAAAGGCAGGATGAGAAATAGG + Intronic
964178493 3:153855685-153855707 CCAAAGGAAACTGGGGAAAAGGG + Intergenic
966724530 3:183097794-183097816 TGAAAGGGAAGACAGGAAATGGG + Intronic
967251382 3:187543737-187543759 GGAAGGGGAAGAGGTGAAATCGG + Intergenic
968593020 4:1469066-1469088 CCAAAGGAAAGAGTGGAAGCAGG - Intergenic
968816538 4:2824490-2824512 CCCAACGGAAGAGGGCAGATCGG - Intronic
969314657 4:6374497-6374519 CAAAAGGCAAGAGGGGACACAGG + Intronic
970449060 4:16149054-16149076 CCAAAGGGTACAGAGGAAAGAGG - Intergenic
970911266 4:21278744-21278766 CCCAAGGGCAGAGGGGAGATGGG + Intronic
971350273 4:25849520-25849542 CCTAAGGGAAGAGGGGATTGAGG + Intronic
971371008 4:26018815-26018837 CCATAAGGAAGGGGGGAGATGGG + Intergenic
971798498 4:31259036-31259058 CCAAGGGGATGAGTGGAAAGTGG - Intergenic
972340628 4:38149488-38149510 ACAAAGGGAAGAAGGGAATGTGG + Intergenic
973728751 4:53802903-53802925 TCAATTGGAAGAGGGGAACTTGG + Intronic
974882529 4:67777376-67777398 CCATATGGCAGAGGGGATATAGG - Intergenic
975242625 4:72079949-72079971 CAGAAGGGAAGAGGGGAAGTTGG - Intronic
976099008 4:81540515-81540537 CCAAAGATAAGAGTGAAAATTGG + Intronic
976465830 4:85367746-85367768 TCACAGGGAACAGGGGAGATGGG + Intergenic
976489478 4:85652681-85652703 TAAAAGAGAAGAGTGGAAATAGG + Intronic
978249734 4:106616157-106616179 GGAAAGGGCAGAAGGGAAATTGG + Intergenic
978305685 4:107325870-107325892 ACAGAGGGAAGAGGGCAAACTGG + Intergenic
978307276 4:107344060-107344082 GGAAAGGTAAGAGGGGAAAGGGG + Intergenic
978803251 4:112775008-112775030 CCCACGAGAAGAGGGGAAACTGG - Intergenic
979131474 4:117051961-117051983 GGAAAGGGAATAGAGGAAATCGG + Intergenic
979508958 4:121529804-121529826 AGAAAGGGAATACGGGAAATAGG - Intergenic
979720942 4:123899777-123899799 ACAAAGGGAAGAGGGGAGACTGG + Intergenic
980126441 4:128778977-128778999 ACACAGGGAAGAGGAGAAAAAGG - Intergenic
980291693 4:130853160-130853182 CCAAAGGAAGGATGGGAATTGGG + Intergenic
980420412 4:132552194-132552216 CCAAAGGAAACATGGGAAATAGG + Intergenic
981204864 4:142028395-142028417 CCAAATGGAAGAGAGGAGAGGGG - Exonic
981300264 4:143178887-143178909 TCAAACTGAAGATGGGAAATGGG - Intergenic
981654354 4:147096175-147096197 AAAAAGAGAAGAGGGAAAATGGG + Intergenic
982293431 4:153802988-153803010 CCAAAGGAAGGAGGGGACAGAGG + Intergenic
982502130 4:156170586-156170608 CCAAAGAGAGGAGGGTAAAGGGG + Intergenic
983111809 4:163759834-163759856 CGAAAGTGAAGAGAGAAAATAGG - Intronic
984184023 4:176520566-176520588 GCCAAGGGAAGAGAGGAAACAGG - Intergenic
984958507 4:185070456-185070478 CCACAGGAAAGAGGAGAGATGGG + Intergenic
985376680 4:189347773-189347795 CCAAAGTTAAGACGGGAGATAGG + Intergenic
985487234 5:158502-158524 GCAGAGGGAGGAGGGGAGATAGG - Intronic
985487280 5:158629-158651 GCAGAGGGAGGAGGGGAGATGGG - Intronic
985487323 5:158755-158777 GCAGAGGGAGGAGGGGAGATGGG - Intronic
985522296 5:381039-381061 CCAAGGGCAAGAGGAGAAAAAGG + Intronic
985650387 5:1104810-1104832 CCCAAGGGGAGAGCGGAAACAGG + Intronic
986240482 5:5955307-5955329 CCAAAGAGAAAAGGGGAAGGAGG - Intergenic
986649956 5:9953493-9953515 CAAAAGGGAGGAGGGGATAATGG + Intergenic
987562802 5:19546006-19546028 CCAAAGGAGAGAGGGAAAACTGG + Intronic
987924764 5:24326202-24326224 CCAAAGAAAATTGGGGAAATTGG + Intergenic
989133040 5:38126265-38126287 GGAAAGGGAAGAGGGGAAAAGGG + Intergenic
989436285 5:41417227-41417249 CCAAAGTGAGGGGTGGAAATAGG - Intronic
991632539 5:68670912-68670934 CCAGAGGGAAGAGAGGAGAAAGG - Intergenic
992167869 5:74072909-74072931 CCAGAGAGAAGAAGGGAAAGAGG - Intergenic
994153228 5:96473812-96473834 CAGAAGGGAAGAGGGGATGTAGG + Intergenic
994608212 5:101998504-101998526 CCTAAGGGAAGAGGTGTTATGGG - Intergenic
994787178 5:104179992-104180014 CCAAAAGGAAGAAGGCAAAAGGG + Intergenic
995720909 5:115131866-115131888 CCTCTGGGGAGAGGGGAAATAGG + Intronic
996567751 5:124897910-124897932 CCAGAGGCAAGGGTGGAAATGGG - Intergenic
996609136 5:125358493-125358515 CAAAAAGGAAGAGAGGAAAATGG - Intergenic
997064451 5:130545256-130545278 TCAAACTGAAGATGGGAAATGGG - Intergenic
997405382 5:133642134-133642156 CAAAAGGGAAGTGAGGAAATGGG + Intergenic
997598789 5:135125584-135125606 CCATAGGGAAAAGCAGAAATTGG + Intronic
998329232 5:141309208-141309230 GAAAAGGGAAGGGGGGAAAAAGG - Intergenic
998652438 5:144135955-144135977 ACAAAGAGAAGAAGAGAAATGGG - Intergenic
998823389 5:146077045-146077067 CTAAAAGGATGATGGGAAATTGG - Intronic
999079465 5:148829207-148829229 CCAAAGGAAAGAAGGAAAAGGGG - Intergenic
999081883 5:148852259-148852281 CCAGAGGGGAGAAGGGATATGGG + Intergenic
999609902 5:153357835-153357857 GCAAAGGTAAGAGTAGAAATAGG + Intergenic
1001123141 5:168996386-168996408 GGGAAGGGAAGAGGGGAAAATGG + Intronic
1001605367 5:172955953-172955975 CAAAAGGGAAAACTGGAAATAGG + Intergenic
1001753779 5:174150784-174150806 CAAAAGGGAAGAGGGGATGAGGG + Intronic
1001782800 5:174385075-174385097 CCAAAGGGAAAAGGGGAAAGTGG - Intergenic
1001854849 5:175002161-175002183 CCAAACAGAAGAGGGAAAAGTGG - Intergenic
1002814469 6:666830-666852 GCTAAGAGAAGAGGGAAAATGGG - Intronic
1003213283 6:4087199-4087221 CTAAAAGGAAGAGGGGAAAGCGG - Intronic
1003255303 6:4470161-4470183 CCAAAGGATAGGGAGGAAATTGG + Intergenic
1003346276 6:5270827-5270849 CCCCAGGGTAGAGGGGAAAGAGG - Intronic
1005088584 6:22032755-22032777 TCAAAGGGAAGAGAGCAAGTAGG - Intergenic
1005365786 6:25075513-25075535 CCAGAGGGAAGAGAGGAAGATGG + Intergenic
1005366284 6:25080920-25080942 GCAAAGGGAAGTGAGGACATAGG + Intergenic
1005808991 6:29502143-29502165 CCAAAGGGAGGAGGGGGAAATGG + Intergenic
1005870772 6:29972809-29972831 CCAGAGGGGAGGGTGGAAATGGG + Intergenic
1006193535 6:32223558-32223580 CCATAGGGAAGAGGGGAAGAGGG - Intronic
1006944499 6:37776436-37776458 CCAGAGGTAAGAGGGGAGTTGGG - Intergenic
1007509502 6:42364405-42364427 TCTAAGGGAAGTGGGGAAAGGGG - Intronic
1008801782 6:55377385-55377407 CCAGAGGGAAGAGGTGGGATGGG + Intronic
1009282240 6:61767549-61767571 ACAAAGGAAGGAGGGAAAATAGG - Intronic
1010766859 6:79784947-79784969 CCAAAGGAAGGGGGGGAAATAGG + Intergenic
1011441063 6:87387871-87387893 ACAAAAGGAAAAAGGGAAATGGG + Intronic
1011759462 6:90545714-90545736 CAGAAGGGAAGAGTGGAAACTGG - Intronic
1011905788 6:92365606-92365628 ACCATGGGAAGAAGGGAAATAGG + Intergenic
1012395412 6:98790715-98790737 GCAAAGGGAAGAGGGGGACCTGG + Intergenic
1015766955 6:136728915-136728937 GGAAAGGGAAGAGAGGAAAAGGG + Intronic
1015892220 6:137980295-137980317 GTAAAAGGAAGAAGGGAAATGGG - Intergenic
1016188015 6:141221680-141221702 ACAAAGGGATGGGGTGAAATTGG - Intergenic
1018601871 6:165552673-165552695 GCAAAGGGAAGAGGTGCACTGGG - Intronic
1018777432 6:167030685-167030707 CCAAAGAGAACAGGGGTAAAAGG - Intronic
1019497635 7:1347850-1347872 CCCAAGGGAACAGGTGCAATGGG + Intergenic
1020430062 7:8109674-8109696 CCAAAGGGACGTGGAGAACTAGG - Intergenic
1020807603 7:12809566-12809588 CCAAAGGGAAGAGGGGAACAGGG - Intergenic
1020976629 7:15014463-15014485 CTAAAGGGAAGTGGGCACATGGG + Intergenic
1021564005 7:21998966-21998988 GCAGAGGGAAAAGAGGAAATGGG + Intergenic
1021870668 7:25002868-25002890 CCCACCAGAAGAGGGGAAATGGG + Intergenic
1022198573 7:28094258-28094280 GAAAAGGGAAGAAGGGATATCGG - Intronic
1022393452 7:29963336-29963358 CTAAAGGGAGGAGTGGATATTGG + Intronic
1022662888 7:32382790-32382812 CCAAAGGTCAGAGTGGAAATGGG + Intergenic
1022714773 7:32889782-32889804 GCAAAGAGAAGAGGGGAAGGGGG + Intronic
1023847148 7:44128787-44128809 CCAAAGGAAAGACAGGAAAGGGG - Intergenic
1025110744 7:56214105-56214127 CCAAGGGGAAGAGTGGGAAGGGG - Intergenic
1026308762 7:69166136-69166158 GGGAAGGGAAGAGGGGAAAGGGG + Intergenic
1026401063 7:70013495-70013517 CAAATGTGGAGAGGGGAAATGGG - Intronic
1027715550 7:81664744-81664766 TTATAGGGAAGTGGGGAAATGGG - Intergenic
1028382732 7:90216489-90216511 AGAAAGTGAAGAGAGGAAATTGG + Exonic
1029374751 7:100170985-100171007 GCAAAGGGCAGTGGGAAAATGGG - Intronic
1029478518 7:100799485-100799507 ACCAAGGGAAGAGGGGACAGAGG + Intergenic
1030187225 7:106776121-106776143 ACAAAGGGATGAGAGAAAATAGG - Intergenic
1030623878 7:111822114-111822136 CCTAGGGGAAGAGGGTCAATGGG + Intronic
1031117755 7:117686647-117686669 CAGAAGAGAAGAGGGGAATTGGG - Intronic
1031460859 7:122046986-122047008 ACAAAGGAAAGGGGGGAAAGTGG + Intronic
1032423617 7:131802763-131802785 ACAGAGGGTAGAGGGGAAATAGG - Intergenic
1032802775 7:135329733-135329755 CCACAAAGAAGAGGGGAACTAGG - Intergenic
1032949223 7:136888275-136888297 TCACAGGGAAGAGGGGAATTTGG - Intronic
1033176829 7:139132510-139132532 TCCCAGGGAGGAGGGGAAATTGG - Intergenic
1033506086 7:142001836-142001858 CCAAAGAGAAGACAGGTAATGGG - Intronic
1033872861 7:145777922-145777944 AACAAGGGAAGAGGGAAAATGGG - Intergenic
1034755155 7:153609959-153609981 AGAAAGGGAAGAGAGGAAAGCGG + Intergenic
1035975307 8:4303949-4303971 GCAAAAGGAAGAGGGAAAAGTGG - Intronic
1036058088 8:5282160-5282182 CCAAAGGGAAAAGGGAAGCTGGG - Intergenic
1036510353 8:9394308-9394330 CACTAGGTAAGAGGGGAAATGGG + Intergenic
1036575751 8:10026405-10026427 ACAAATGGGAGATGGGAAATGGG - Intergenic
1037547484 8:19939086-19939108 CCAACGAGAAGAGGGGGAAAGGG - Exonic
1038934411 8:32232570-32232592 ACAAAGGGAAAGGGGGAAAATGG + Intronic
1039179333 8:34847197-34847219 GCAAAGTGAAGAGAGGAAAATGG - Intergenic
1039631853 8:39121249-39121271 CTAAAGGGAACAGAGAAAATTGG + Intronic
1040552696 8:48450724-48450746 TCCAAGGGAAGAGAGGAAAGAGG + Intergenic
1040901039 8:52417368-52417390 CCAAGGGAAAGAGGGGAGTTGGG + Intronic
1041009577 8:53528978-53529000 AGAAAGAGAAGAGGAGAAATAGG - Intergenic
1041019991 8:53629076-53629098 CCAAAGGAAAGATGGGCAAAAGG - Intergenic
1041631010 8:60086887-60086909 ACAAAGAGCAGAGGGGAGATTGG - Intergenic
1041850450 8:62385496-62385518 ACATGGGGAAGAGGGGAAAAGGG + Intronic
1044212239 8:89563285-89563307 AGAAAGGGAAGATGGGAAAAGGG - Intergenic
1044396575 8:91720415-91720437 CCAAAGGGAGGAGGGTAGAATGG + Intergenic
1044756954 8:95473566-95473588 GGAAAGGGGAAAGGGGAAATGGG - Intergenic
1045237828 8:100371461-100371483 CCAAAGAGAAAGGGGGAAATGGG - Intronic
1046414872 8:113899553-113899575 CCCAAGGGAAGAGGAGAAGCAGG + Intergenic
1046983349 8:120360854-120360876 CCAAAGAGCAGAGGGCAAAGGGG - Intronic
1047145734 8:122197204-122197226 CCAAAAGGCAGAGAGGAAACAGG + Intergenic
1047721151 8:127640913-127640935 CCAGAGGGAAGGGAGGAATTTGG + Intergenic
1048161648 8:132026996-132027018 GCAAAGGGAAAAGGGAAAAATGG - Intronic
1048842377 8:138577281-138577303 GCAAAGAGAAGAGGGGAGGTGGG - Intergenic
1051219406 9:14832447-14832469 CAAAAGGGAAGAGAAAAAATAGG + Intronic
1051261109 9:15265640-15265662 AAAAAGGGAGGAGGGGAAAAAGG + Intronic
1052597540 9:30579201-30579223 CCAAATAGCAGAGGGAAAATTGG - Intergenic
1052740243 9:32385161-32385183 CCAAGGGGTAAAGGGAAAATGGG + Intronic
1054968920 9:71061894-71061916 CCCAAGGGGAGAGGGGTAATGGG + Intronic
1055981645 9:82008970-82008992 GCAAAGTGAAGAGGGGAATTTGG - Intergenic
1056297581 9:85207918-85207940 ACAAAGGGAAGAGGTGTAATTGG - Intergenic
1057255727 9:93545498-93545520 CCAAAAGAAACAGGGGCAATAGG - Intronic
1058043772 9:100334063-100334085 TGAAAGGGAAGAAGAGAAATTGG + Intronic
1058784636 9:108374969-108374991 GCAGTGGGGAGAGGGGAAATGGG - Intergenic
1058903688 9:109463109-109463131 CCTCAGGGCAGAGGTGAAATTGG + Intronic
1059371404 9:113842541-113842563 CAAAGGGGAAGAGGAGAATTGGG + Intergenic
1059846290 9:118280799-118280821 CCAATGGGTTGAGTGGAAATGGG + Intergenic
1060011106 9:120043399-120043421 CTAAAGAGGAGAGGGGAAAAGGG + Intergenic
1060034453 9:120242905-120242927 CCCAAGGGAAGCAGGGAGATGGG + Intergenic
1060769208 9:126318767-126318789 ACACAGGGAAAAGGGGAAACAGG + Intergenic
1060899920 9:127248253-127248275 CCAAAAGGGAGAGAGGAAATGGG - Intronic
1061830040 9:133285897-133285919 ACAAAGGAAAGAGGGGCATTTGG - Intergenic
1061861234 9:133469678-133469700 CCACAGGGCAGAGGGAATATGGG - Exonic
1062117172 9:134815691-134815713 CCACCAGAAAGAGGGGAAATGGG - Intronic
1062374648 9:136256471-136256493 CCAATGGGAGGAGGGGAATCTGG - Intergenic
1185840760 X:3389074-3389096 CCAAAGGGAAGAGAGGTGAATGG + Intergenic
1185956217 X:4493746-4493768 CCAAAGGGAAGATTAAAAATAGG + Intergenic
1186946258 X:14571064-14571086 GAAGAGGGAAGAAGGGAAATAGG + Intronic
1187113816 X:16328966-16328988 TCAAAGGGAAGAGATGATATAGG + Intergenic
1187631068 X:21173036-21173058 CAATAGGGAAGAGGGAAAACAGG + Intergenic
1187750065 X:22453036-22453058 TTAAAGGAAATAGGGGAAATTGG - Intergenic
1188904845 X:35779469-35779491 GCAAAGGGAAAAGGAGGAATAGG + Intergenic
1189043482 X:37567606-37567628 GCAAAGGAAAGAGGAGAATTAGG + Intronic
1189139321 X:38584806-38584828 GGAAAGGGAAGAGGGGAATGAGG - Intronic
1189384877 X:40529094-40529116 GGAAAGGGTAGAGGGGAGATGGG + Intergenic
1189700778 X:43715155-43715177 CCACAGGGAAGAGGGTACATAGG + Intronic
1190026950 X:46933188-46933210 ACAAAGGGGAGAGGGAACATGGG - Intronic
1190248367 X:48705429-48705451 CCTCAGGGAAGAGGGGCCATGGG + Intronic
1190708920 X:53051263-53051285 GCCAAGGGAAGAGGAGGAATGGG + Intronic
1191224373 X:58026705-58026727 ACAAAGTAAAGAGGGGAAAAAGG + Intergenic
1191846116 X:65549512-65549534 CCAAAGGGAGGAGGGTGAACAGG + Intergenic
1191851910 X:65591542-65591564 CAAAAGGAAAGAAGGGAAAGTGG - Intronic
1191899977 X:66030951-66030973 CCGTAGGGCAGAGGTGAAATAGG + Intronic
1192108711 X:68342393-68342415 CCAATGGGAAAAGGGAAAATAGG + Intronic
1192382051 X:70627225-70627247 ACAAAGGGAAGAAGAGAAATTGG + Intronic
1192596330 X:72412395-72412417 TCAAAGGGAAGTGAGAAAATTGG - Intronic
1193310199 X:79998842-79998864 CCAAAGAGAAGATGAGACATGGG + Intergenic
1194498339 X:94646838-94646860 CTAAAGGGAACAGAGAAAATTGG - Intergenic
1194823228 X:98530978-98531000 AAAAAGGGAAGAGGGGAACAAGG + Intergenic
1195500940 X:105598298-105598320 CTAGATGGAAGTGGGGAAATGGG + Intronic
1195670069 X:107462190-107462212 CAAAAAGGAAGAGGTGGAATTGG - Intergenic
1195878969 X:109572962-109572984 CCAAAGGGAGGAAGGGAAGTAGG - Intergenic
1196778198 X:119360139-119360161 CCGAAGGGAACAGGACAAATGGG - Intergenic
1196862851 X:120043865-120043887 CCAAAGGCAAGATGGGACTTTGG - Intergenic
1196867130 X:120080389-120080411 CCAAAGGGGGGAATGGAAATAGG - Intergenic
1196875969 X:120155893-120155915 CCAAAGGGGGGAATGGAAATAGG + Intergenic
1196880251 X:120192479-120192501 CCAAAGGCAAGATGGGACTTTGG + Intergenic
1197546376 X:127829999-127830021 CCAGTGGAAAGTGGGGAAATTGG - Intergenic
1197753050 X:129978938-129978960 CCAAAGGAGAGAAGGGACATCGG + Intergenic
1197886552 X:131223998-131224020 CAAAAGGGAAGAGAGTGAATAGG + Intergenic
1197992127 X:132329591-132329613 CAAAAAGAAGGAGGGGAAATGGG + Intergenic
1198548671 X:137721288-137721310 ACAAAGGTAAAACGGGAAATAGG + Intergenic
1198706223 X:139451348-139451370 GTAAAGGGAAGACAGGAAATGGG + Intergenic
1199585796 X:149414606-149414628 CCATAGGCAAGAAGAGAAATGGG - Intergenic
1199680941 X:150224193-150224215 CCAAGGAGAGGAGGGGAAACAGG - Intergenic
1199757682 X:150880538-150880560 CCAGGGGGAAGGTGGGAAATGGG + Intronic
1200180942 X:154150352-154150374 GCAAAGGGAAGAGGGGAGCAGGG + Intronic
1200186585 X:154187466-154187488 GCAAAGGGAAGAGGGGAGCAGGG + Intergenic
1200192237 X:154224604-154224626 GCAAAGGGAAGAGGGGAGCAGGG + Intronic
1200197992 X:154262408-154262430 GCAAAGGGAAGAGGGGAGCAGGG + Intronic
1200883865 Y:8249775-8249797 CCAAAGGGAAGAGGAGGAGGAGG - Intergenic
1201235217 Y:11903035-11903057 CCAAAGGGAAGAGAGGTGAATGG - Intergenic
1201452910 Y:14135898-14135920 CCAAAGGGAGGAGAGGAACAAGG + Intergenic
1201629692 Y:16056698-16056720 AGAAAGGGAGGAGGGGACATGGG - Intergenic
1202365302 Y:24157608-24157630 TCAAAGGGAAAAGGTAAAATTGG - Intergenic
1202505479 Y:25512514-25512536 TCAAAGGGAAAAGGTAAAATTGG + Intergenic