ID: 1090190212

View in Genome Browser
Species Human (GRCh38)
Location 11:124762125-124762147
Sequence GGTCACCAGGGGCCCCGGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 382}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090190202_1090190212 3 Left 1090190202 11:124762099-124762121 CCCAGGAACAAAAACCGCAGCAA 0: 1
1: 0
2: 1
3: 10
4: 173
Right 1090190212 11:124762125-124762147 GGTCACCAGGGGCCCCGGGAGGG 0: 1
1: 0
2: 2
3: 43
4: 382
1090190201_1090190212 4 Left 1090190201 11:124762098-124762120 CCCCAGGAACAAAAACCGCAGCA 0: 1
1: 0
2: 0
3: 11
4: 172
Right 1090190212 11:124762125-124762147 GGTCACCAGGGGCCCCGGGAGGG 0: 1
1: 0
2: 2
3: 43
4: 382
1090190203_1090190212 2 Left 1090190203 11:124762100-124762122 CCAGGAACAAAAACCGCAGCAAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1090190212 11:124762125-124762147 GGTCACCAGGGGCCCCGGGAGGG 0: 1
1: 0
2: 2
3: 43
4: 382
1090190200_1090190212 18 Left 1090190200 11:124762084-124762106 CCGAGGGCACTCAGCCCCAGGAA 0: 1
1: 0
2: 5
3: 43
4: 301
Right 1090190212 11:124762125-124762147 GGTCACCAGGGGCCCCGGGAGGG 0: 1
1: 0
2: 2
3: 43
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090190212 Original CRISPR GGTCACCAGGGGCCCCGGGA GGG Exonic
900091320 1:922001-922023 AGACACCATGGGCCCCGGGTAGG + Intergenic
900130220 1:1084218-1084240 GGTCTCCTGGGGACCCGGGCAGG + Intronic
900191506 1:1354160-1354182 GGTCCCCAGGAGGGCCGGGAGGG + Intronic
900244652 1:1631520-1631542 GGTCTCCCGGGGAGCCGGGAAGG - Intergenic
900410641 1:2511007-2511029 GGACCCCAGAGGCACCGGGACGG + Intronic
900481814 1:2902996-2903018 GGCCACCGGAGGCCCAGGGAGGG - Intergenic
900565736 1:3331068-3331090 GGGCTCCAGGGGCCAAGGGAGGG + Intronic
900994564 1:6113522-6113544 GGTGTCCAGGGGCCCCAGGTTGG + Intronic
901026734 1:6282310-6282332 GCTGACCTGGGGCCCCGGGAAGG + Intronic
901530747 1:9851050-9851072 GGTCACCTGGGGCCTCGTCATGG - Intronic
901658296 1:10783116-10783138 GGTGGCCGGTGGCCCCGGGAGGG - Intronic
901674166 1:10873234-10873256 GGGGATCAGGGGCCCCTGGACGG + Intergenic
901840354 1:11950297-11950319 GGTGAGCAGGGGCCCAGTGAGGG - Intronic
902179110 1:14674406-14674428 GGTCACCCTGGGCTCCTGGAAGG + Intronic
902643589 1:17782145-17782167 GGTCTCCAGAGGCCCAGGGATGG - Intronic
903142965 1:21350697-21350719 TTTCACCAGGGGCCCAGGGCAGG - Intergenic
903446398 1:23424940-23424962 GGTCCCCCGGCGCCCCTGGAAGG - Intergenic
903986932 1:27235079-27235101 GGACACCCGGGGCCCCGAGGCGG - Intronic
904111413 1:28129211-28129233 GATCACAAGGGGACCAGGGAAGG + Intergenic
904321690 1:29701928-29701950 TGTCCCCAGGGTCCCAGGGAAGG - Intergenic
905167990 1:36094337-36094359 GTCCACCCGGGGCCCCGTGATGG - Intergenic
905390762 1:37634298-37634320 GATCACCCGGGGCTGCGGGATGG + Intronic
906556944 1:46721683-46721705 GGTCACCAGAAGCCCCAGGCAGG + Intergenic
906913315 1:49980434-49980456 GGTAACCAGGGGCCGAGGGAAGG - Intronic
910462771 1:87466572-87466594 AGTCACCAAGGGCCCCGAGGTGG - Intergenic
910980297 1:92953716-92953738 GGTCACCAAGGGCCAGGGGCAGG + Intronic
911126691 1:94347211-94347233 GGCCACCTGGGGCCACTGGAAGG - Intergenic
913312542 1:117515799-117515821 GGTTACCAGGGACCTGGGGAGGG + Intronic
915290227 1:154878532-154878554 GGCCACCTGGGGTCCAGGGAGGG - Intergenic
915678263 1:157552297-157552319 GCTCACCATGGGCCCTGGGTGGG - Intronic
915734127 1:158073975-158073997 GGGCTCCAGGGGCCATGGGAAGG + Intronic
915841244 1:159215163-159215185 GGTCAACAGGGGGCAAGGGAAGG + Intergenic
916144300 1:161726093-161726115 AGAGACCAGGGGCCCCGGGAGGG + Intronic
916773633 1:167937008-167937030 GGTGAGCGGGGGCCCCGGGGCGG + Exonic
916787437 1:168096745-168096767 GGTCACCTGGGGCCCCTACATGG - Exonic
917961654 1:180150528-180150550 GGTGACCTGGGGACCAGGGAAGG + Intergenic
919115756 1:193278548-193278570 GGTTACCAGGGGCATGGGGAGGG - Intergenic
919548072 1:198949048-198949070 GGCCCCCTGGGGCCCTGGGATGG + Intergenic
919914299 1:202130326-202130348 GGGCCCCGGGGGCCCAGGGATGG + Exonic
919944656 1:202310361-202310383 AGTGACCAGGGGCCCTGGGTTGG + Intronic
920433917 1:205936189-205936211 GGACACCAGGGGTCAGGGGAGGG - Intronic
921870642 1:220135935-220135957 GGTTGCCAGGGGCCCTGGGGTGG - Intronic
922796351 1:228341626-228341648 AGCCACCTGGGCCCCCGGGAAGG - Intronic
923539094 1:234875615-234875637 GCTCATCAGAGGCCCCGGGTGGG + Intergenic
924868916 1:248018810-248018832 GGACCCCAGGGGACCGGGGAAGG - Intronic
924920792 1:248627078-248627100 GTTCACCAGAAGCCCCAGGAGGG + Exonic
1064738869 10:18412008-18412030 GGTGACCAGGTGACCTGGGATGG + Intronic
1066431112 10:35352734-35352756 GGACACCAGAGTCCCCTGGATGG + Intronic
1067439431 10:46300340-46300362 GGTCTCCAGGGAGCCCAGGAAGG + Intronic
1070018836 10:72563555-72563577 GGTTACCAGGGGCTGAGGGAAGG + Intronic
1070792809 10:79199715-79199737 GGGCACCAGGGGACTGGGGACGG + Intronic
1070965719 10:80529125-80529147 GGGTACCAGGGGACCTGGGAGGG + Exonic
1073012498 10:100372386-100372408 GGTCACCAGGGGCCGAGTGTGGG - Intergenic
1073026400 10:100490056-100490078 GGGCACCTGGGTCCCCTGGAAGG + Exonic
1074776539 10:116771653-116771675 GTTTACCAGGAGCCCAGGGACGG + Intergenic
1075223746 10:120606667-120606689 GGACACTAGTGGCCCCAGGAGGG + Intergenic
1075315127 10:121447068-121447090 GGTCACTAGGGGCTGGGGGAGGG + Intergenic
1075583213 10:123637924-123637946 TGTGAGCAGGGGCCCCAGGAAGG - Intergenic
1075616079 10:123891693-123891715 GGTCACCGGGGGCGCCGGGCGGG + Exonic
1076552247 10:131288822-131288844 GGACACCAGGAGCCGGGGGAGGG + Intronic
1076640877 10:131916543-131916565 GGTCGCCAGGGGCCGGGGAAGGG - Intronic
1076713750 10:132353061-132353083 GGACTCCTGGGGCCCAGGGAGGG - Intronic
1076851591 10:133095953-133095975 GATCACCAGGGGGCTGGGGAGGG + Intronic
1077432848 11:2524609-2524631 ACCCACCAGGGGCCCTGGGAAGG - Intronic
1077726328 11:4678675-4678697 GGTTACCAGGGGCTGGGGGAGGG - Intergenic
1078185527 11:9048905-9048927 GGTCAACAGGGGCCACAGGAAGG + Intronic
1078632833 11:13019161-13019183 GGTCACCAGGGGCTGGGAGAAGG - Intergenic
1079091925 11:17486816-17486838 GATTACCAGGGGCCGCGGGGCGG + Intergenic
1079106697 11:17576614-17576636 GCTCACCAGTGGCCCAGGGATGG - Exonic
1079698989 11:23520351-23520373 AGGCCCCAGGGGCCCTGGGATGG + Intergenic
1080223274 11:29931943-29931965 GGTAACCAGGGGCTGAGGGAAGG + Intergenic
1081798876 11:45843338-45843360 GGTAACCAGGCGCGGCGGGAGGG - Intergenic
1082787230 11:57323967-57323989 GGTCACCTGGGGCCCCTGGCTGG - Intronic
1083378231 11:62243603-62243625 GGTCACCTGGGGCCACAGGGTGG + Intronic
1084578525 11:70007092-70007114 GGTTGCCAGGGGCTCAGGGAGGG - Intergenic
1085685327 11:78616643-78616665 GGTCACCAAGGCCCCCAGGCTGG + Intergenic
1087424448 11:97970077-97970099 GGTCACTAGGGTCCCCGCCAGGG + Intergenic
1088919691 11:114252012-114252034 GGTCTCCAGGGGCACGGGGAGGG - Intergenic
1089357735 11:117866119-117866141 GGTTGCCAGGGGCACCGGGAAGG + Intronic
1089771802 11:120808547-120808569 GGACACCAGGGGGCCCGTCATGG + Intronic
1090190212 11:124762125-124762147 GGTCACCAGGGGCCCCGGGAGGG + Exonic
1090777047 11:129975000-129975022 GGTTACCAGGGGCCAGGGCAGGG + Intronic
1090952648 11:131487143-131487165 GGCTTCCAGGGGCCCAGGGATGG - Intronic
1091563257 12:1630150-1630172 CGTCCCCAGGCTCCCCGGGAGGG - Intronic
1092103508 12:5904594-5904616 GGTCACCTGGGGCTCTGGCAGGG - Intronic
1095094418 12:38138203-38138225 GGTCCCCAGGGGCAACAGGAGGG - Intergenic
1096157352 12:49347918-49347940 GATCCCCAGGGGGCCGGGGAGGG + Exonic
1096691547 12:53325073-53325095 GGGCTCCAGCGGGCCCGGGAAGG - Intergenic
1101698459 12:107149174-107149196 GGTGGCCAGGGGGCCTGGGATGG + Intergenic
1101751421 12:107585634-107585656 GGTGCCCAGGGGACCTGGGAAGG - Intronic
1102080650 12:110095220-110095242 GGTTACCAGGGGCTGCAGGAAGG - Intergenic
1102473129 12:113171237-113171259 AGTTACCAGGGGCTGCGGGAGGG + Intronic
1102476441 12:113191708-113191730 AGTCACCAGGGGGCTCCGGAAGG - Exonic
1102731688 12:115116854-115116876 GGTTACCAGGGGCTGAGGGATGG - Intergenic
1102953811 12:117046735-117046757 AGGCACCAGGAGCCCCGGGCGGG + Intronic
1103611969 12:122129539-122129561 GGTCACCAATGGCCCTAGGAGGG - Intronic
1103895131 12:124268042-124268064 GGGCACCAGGGTCCCAGGAATGG + Intronic
1103991330 12:124801274-124801296 GGTGACCAGGGGCTGGGGGAGGG + Intronic
1104490072 12:129186370-129186392 GGAAACCAGGGGGCCTGGGAGGG - Intronic
1104941540 12:132397683-132397705 GGCCAGGAGGGGCCCCGGGGAGG - Intergenic
1104956531 12:132469276-132469298 GGGCACCAGGGGGGCCAGGAAGG + Intergenic
1106235971 13:27860755-27860777 GGTTACCAGGGGTGCAGGGAAGG - Intergenic
1106592741 13:31111105-31111127 GGGCACCAGGTGCCCTTGGATGG + Intergenic
1108583680 13:51849322-51849344 GGTCACCAGGGGCTGGAGGAAGG + Intergenic
1109340394 13:61050966-61050988 GGTCACCAGGGGCAGGGGTAGGG + Intergenic
1109364124 13:61333530-61333552 GGTTACCAGGGGCTCAAGGAGGG + Intergenic
1111985374 13:95060908-95060930 CGTCACCAGGGGCTGAGGGAAGG - Intronic
1112311971 13:98326468-98326490 GCTTACCAGGGGCCAAGGGAGGG - Intronic
1112692793 13:101916293-101916315 GGACTCCAGGGTCCCCGCGACGG + Intronic
1112709821 13:102114809-102114831 GGTTACCAGGGGCTGAGGGAAGG + Intronic
1112790032 13:102993150-102993172 GGTTACCAGGGGCCAGGGAATGG - Intergenic
1113560198 13:111272644-111272666 GGTCACCTGGGTCTCCTGGATGG + Intronic
1113709058 13:112452288-112452310 TATCACCAGGGCCCCCGGAATGG + Intergenic
1113746092 13:112745930-112745952 GGTCACCAGGGCCTGGGGGAGGG - Intronic
1113766184 13:112882347-112882369 GGCCACCATGGGTCCCTGGACGG - Exonic
1113999535 14:16400247-16400269 GGTTGCCAGGGGCTCAGGGAGGG + Intergenic
1114046440 14:18880518-18880540 GGTGCCCAGGGGCCTCTGGAGGG + Intergenic
1114117772 14:19638932-19638954 GGTGCCCAGGGGCCTCTGGAGGG - Intergenic
1116992714 14:51292759-51292781 GGTCATCAGGGGCTGGGGGACGG - Intergenic
1120851532 14:89176487-89176509 GTTCAGCTGGGGCCCAGGGAGGG - Intronic
1120954231 14:90067437-90067459 GGTTACCAGGGGCTGAGGGACGG + Intronic
1122217675 14:100214627-100214649 GGGGACGAGGGGCCCCGGGGAGG - Intergenic
1122695593 14:103550676-103550698 GGTCATGAGGGGCCCAGGGCAGG - Intergenic
1122903896 14:104793197-104793219 TGTCACCAGGGGCTTAGGGAAGG - Exonic
1128057112 15:64708359-64708381 GGTCACCAGAGGCCGGGGGCAGG - Intergenic
1128656682 15:69467759-69467781 GCCCAACAGGGGCCCTGGGAGGG - Intergenic
1129481218 15:75827948-75827970 ACTCACCATGGGCCCTGGGATGG - Intergenic
1129716358 15:77853536-77853558 GGTCACCAGAGGCTAGGGGAAGG + Intergenic
1129719556 15:77870681-77870703 GATCACCAGGTGCGCAGGGAAGG - Intergenic
1130255881 15:82325896-82325918 GGTCCCCAGAGGCCCCAGGGAGG + Intergenic
1131019916 15:89088867-89088889 GGTCTTCAGGGGCCTGGGGAGGG + Intronic
1131214987 15:90529531-90529553 GGTCACCTCGGGCCCCCGCAGGG - Intergenic
1131473276 15:92714612-92714634 GGCCTCCAGGGGCCGCGGGAAGG - Intronic
1132024489 15:98393170-98393192 AGTCACCACCGGCCCAGGGAAGG + Intergenic
1132519883 16:382072-382094 GGTCACGTGGGGCGCCGGTAGGG + Intronic
1132576911 16:668448-668470 GCTCACCAGGGACCCCCGGCTGG - Intronic
1132617264 16:847880-847902 GGGAACCCGGGGCACCGGGAGGG - Intergenic
1132870503 16:2113710-2113732 CTTCACCAGGGGCCTTGGGAGGG - Intronic
1132880960 16:2161506-2161528 GGCCACCTGGGCCCCCGGGCAGG + Intronic
1133327996 16:4953733-4953755 GGTTTCCAGGGGCTGCGGGAAGG + Intronic
1133470616 16:6071746-6071768 GGTAACCAGGAGCCACGGGGAGG - Intronic
1134522032 16:14923193-14923215 CTTCACCAGGGGCCTTGGGAGGG + Intronic
1134709701 16:16321844-16321866 CTTCACCAGGGGCCTTGGGAGGG + Intergenic
1134716914 16:16361874-16361896 CTTCACCAGGGGCCTTGGGAGGG + Intergenic
1134949902 16:18346801-18346823 CTTCACCAGGGGCCTTGGGAGGG - Intergenic
1134957837 16:18390285-18390307 CTTCACCAGGGGCCTTGGGAGGG - Intergenic
1135729733 16:24883970-24883992 GGTCACCAAGGGAACCTGGAAGG - Intronic
1136005660 16:27327144-27327166 GGACAGCAGGGGCCTCGGGTGGG - Intronic
1136127683 16:28196393-28196415 GGTCACCAGGGGCTGGGGCAAGG + Intronic
1136227122 16:28866633-28866655 GGTCTCCAGGGGCCCAGCGGAGG - Exonic
1136383989 16:29911416-29911438 GGACACCAGGACCCCCGGGGAGG - Intronic
1137252813 16:46752161-46752183 GGTCACCAGAAGGCCAGGGAAGG - Intronic
1139448666 16:67014045-67014067 GGTCAGCAGGGGCCCCGCAGAGG - Intergenic
1139633231 16:68243282-68243304 GGTGACCATGGGCCCCTGGAAGG - Intergenic
1139966289 16:70747285-70747307 GGTCGCCAGGGGCGTGGGGAGGG + Intronic
1141205819 16:81932522-81932544 GGGCACAAGAGGCCCCAGGAAGG - Intronic
1141649494 16:85385495-85385517 GCTCCCCAGGGCCCCCGAGAAGG - Intergenic
1141961664 16:87413147-87413169 CATCACCAGCTGCCCCGGGAAGG - Exonic
1142000682 16:87662594-87662616 GGCCACCAGGGGGCCAGGAAAGG - Intronic
1142182671 16:88678857-88678879 AGTGGCCAAGGGCCCCGGGAGGG - Intronic
1142191169 16:88718653-88718675 GGTTACTAGGGGCCAGGGGAGGG + Intronic
1142343181 16:89537275-89537297 GGACCCCAGAGCCCCCGGGAAGG + Intronic
1142619380 17:1154999-1155021 GGCCCCCAGGGCGCCCGGGAAGG - Intronic
1142961956 17:3556916-3556938 GGAAACCAGAGGCCCTGGGAGGG - Intronic
1143096569 17:4481401-4481423 TTTCAGCAGGGGCCCAGGGAGGG + Intronic
1143524559 17:7464501-7464523 GGTGAGCAGGGGCCTCAGGATGG + Intronic
1144280912 17:13725691-13725713 GGACAGCAGGGGCTCCAGGAAGG + Intergenic
1144490447 17:15704331-15704353 GGGCCCCAGGGGGCCTGGGAGGG - Intronic
1144525556 17:15986641-15986663 GGTTACCAGGGGCCTTGGGGTGG + Intronic
1144775741 17:17783721-17783743 GGTCACCGGGCGCCCCGGCCAGG - Intronic
1145056136 17:19705306-19705328 GGGCACGAGAGGCCCGGGGAGGG + Intronic
1145304407 17:21665395-21665417 CCTCACCAAAGGCCCCGGGAAGG - Intergenic
1145983269 17:29027028-29027050 GGTCACCACAGGCTCAGGGAGGG + Intronic
1146639322 17:34527976-34527998 AGTCAGCAGGGGCCTAGGGAAGG - Intergenic
1147734300 17:42625175-42625197 GGTCCCCAGGGTACCCGGAAGGG + Intergenic
1147760594 17:42795319-42795341 GGCCACCAGGAGCAACGGGAGGG - Exonic
1148342048 17:46878996-46879018 AGTCCCCAGGGGCCCCAAGAGGG - Intronic
1148794569 17:50190819-50190841 TGTCACCAGGGGCACCAGCAGGG + Exonic
1149654340 17:58302403-58302425 GGTCCCCAGGGCCCCCAGGTGGG - Exonic
1150124563 17:62627886-62627908 CGTCCCCAGGGGCGCCGGGACGG - Exonic
1151337258 17:73447322-73447344 GGCTACCAGGGACCCAGGGAGGG - Intronic
1151598811 17:75093971-75093993 TTTCACCAGGGGCCCCTGGCTGG + Intronic
1152590418 17:81208873-81208895 GGGCACCTGAGGTCCCGGGAAGG + Intronic
1153169750 18:2302350-2302372 GGTGAACAGGGGCCTGGGGATGG + Intergenic
1153771820 18:8422848-8422870 GGCCACCAGGGGCTGGGGGATGG + Intergenic
1153813135 18:8769644-8769666 GGTCACCAGGCCACCTGGGATGG - Intronic
1154393562 18:13965978-13966000 GGTTACCAGGGGCTGGGGGATGG + Intergenic
1155071809 18:22323547-22323569 GGTTACTAGGGGCTGCGGGAAGG - Intergenic
1155074633 18:22343751-22343773 AAACATCAGGGGCCCCGGGAGGG - Intergenic
1155431297 18:25762049-25762071 GGTCACCAGGGGCTGAGGGTAGG - Intergenic
1155474854 18:26227124-26227146 GGTCACCAGGGTCCCCACGGGGG - Exonic
1156479571 18:37427514-37427536 GGTCCCCAGAGGCCACGGAAAGG - Intronic
1157607577 18:48935529-48935551 GGTCTCCAGGGGCCCAGGAAGGG + Intronic
1158530375 18:58255618-58255640 GGTGACCAGGGGGGCCAGGAGGG - Intronic
1160222068 18:76984965-76984987 TGCCACCAGGGCCCCGGGGAAGG + Intronic
1160564960 18:79781413-79781435 GGTCACCACGTGCCCCGCCAGGG + Intergenic
1160605339 18:80045765-80045787 GGGCATCAGGGTCCCTGGGAAGG - Exonic
1160700887 19:506800-506822 GCTCTCCAGGGCCCCCGGGCTGG - Intergenic
1160769985 19:826485-826507 GGTTGCCAGGGGCCGGGGGAGGG - Intronic
1160776930 19:860852-860874 GGTCCCCAGGGCCGACGGGAAGG + Exonic
1160793893 19:935051-935073 AGTCAACAGGGGCCCCAGTAGGG - Intronic
1161473399 19:4472465-4472487 GGGCAGCGGGGGCCCCGGGCCGG + Intronic
1161495638 19:4584423-4584445 GGCCTTCAGGGTCCCCGGGATGG + Intergenic
1161978750 19:7619886-7619908 GGTCCCAAGGGGGCCCGGGGTGG - Intronic
1162014980 19:7840628-7840650 GGTCACCAGGGGCCAGGGGGAGG - Intronic
1163184441 19:15628239-15628261 GGTCTCCAGGGGCAGCAGGAGGG + Intronic
1163401398 19:17095366-17095388 GGTTGCCAGGGACTCCGGGAGGG - Intronic
1163495976 19:17646865-17646887 TGTCCCCAGTGGCCCCAGGATGG + Intronic
1163529735 19:17842384-17842406 GGCCACCAAGGGCCCCAGGGAGG + Exonic
1163603993 19:18264376-18264398 GGTCTCACGGGGCCCAGGGAGGG + Exonic
1164915372 19:32047618-32047640 GGTCTGCAGAGGCCTCGGGAGGG + Intergenic
1165161739 19:33820539-33820561 TATCCCCAGGGGCCCCGGGCTGG + Intergenic
1165537174 19:36458481-36458503 GGTCACCAGGGGTTGGGGGACGG + Intronic
1165791613 19:38496169-38496191 GGTCACCAGGGGCCCAGGTCCGG - Intronic
1166110164 19:40617189-40617211 GGTTACGAGGGGGCACGGGATGG + Exonic
1166726113 19:45028781-45028803 CGTCTCCAGGGCCCCGGGGATGG + Intronic
1166994858 19:46715532-46715554 GGACACCAGGGTCCCCAGGGTGG - Intronic
1167423915 19:49419949-49419971 AGTCAGCAGGGGCCCAGGGAGGG + Intergenic
1167437190 19:49486339-49486361 GGTCCCCTGGAGCCCCGGGCCGG + Intergenic
1167768483 19:51499670-51499692 AGACTCCAGGGTCCCCGGGATGG + Exonic
1168300364 19:55401535-55401557 GGGCCCCAGGGGGCCCGGGAGGG - Exonic
1168354812 19:55694604-55694626 GGTGCCCAGAGGCCTCGGGAAGG - Intronic
1168444511 19:56400398-56400420 GGTGACCAGGGGTCTCAGGATGG - Intronic
925006488 2:447135-447157 GGTCACAAGGGACCAAGGGAGGG - Intergenic
925075857 2:1014967-1014989 GGAAGCCGGGGGCCCCGGGAGGG + Intronic
925224687 2:2172839-2172861 TGTCACCAGGAGCCCCGTGCTGG + Intronic
927423078 2:22953299-22953321 GGTCAGCAGGGGCCCGGGGCTGG - Intergenic
927622862 2:24680551-24680573 GGTTACCAGGGGCTGCGTGAAGG + Intronic
927869086 2:26612527-26612549 AGCCACCAGGGACCCTGGGAGGG - Intronic
932191076 2:69741985-69742007 GCGCACCTGGGGCCCCGGGCCGG - Exonic
932432633 2:71685081-71685103 GGCCTCCAGGGGCCTGGGGAAGG + Intronic
934921373 2:98347397-98347419 GGCCCCCAGGGGCGTCGGGAGGG - Intronic
935754308 2:106265144-106265166 GGGCACCATGGGCCTCAGGAGGG + Intergenic
938065519 2:128280121-128280143 GGGCACCGGGGGCCCCTGGTGGG - Intronic
938110740 2:128563259-128563281 CTACACCAGGGGCCCGGGGAGGG + Intergenic
938190211 2:129272955-129272977 GGTTACCAGGGGCTAGGGGAAGG + Intergenic
938236417 2:129709990-129710012 GGCCTCCAGGGGCCGCGTGAGGG - Intergenic
940177670 2:150896887-150896909 GGTCACTTGGGGACCCGGCATGG - Intergenic
940316871 2:152335747-152335769 GGGGACCCGGGGCCCCGGGCCGG + Intronic
946168532 2:217879845-217879867 GGGACCCAGGGGCCCCAGGATGG + Intronic
946396085 2:219444430-219444452 AGTAACCAGGGGCCCAGAGATGG + Intronic
947168166 2:227283813-227283835 GGTTCCCAGGGGGCCCTGGAGGG - Exonic
948981216 2:241495887-241495909 GCTGCCCAGGGGCGCCGGGAAGG + Intronic
948993244 2:241565012-241565034 GGGCACCTGGGGGCCAGGGAGGG + Intronic
949013754 2:241697659-241697681 GGTTGCCAGGGGCCTCGGGAGGG + Intergenic
1170474432 20:16700949-16700971 GGTCACCAGGAGCCAGGTGAGGG - Intergenic
1171726949 20:28632401-28632423 GGTTGCCAGGGGCTCAGGGAGGG + Intergenic
1171751309 20:29052214-29052236 GGTTGCCAGGGGCTCAGGGAGGG - Intergenic
1172010921 20:31845158-31845180 GGGCACCCGGGGCCCCGCCAAGG - Exonic
1172165121 20:32894187-32894209 GGCCACCAGGGGCCCCATGCAGG + Intronic
1172623945 20:36336860-36336882 GGGCTCCAGTGGCCCCAGGAAGG - Intronic
1174045212 20:47728331-47728353 CTGCACCAGGGGCCCAGGGACGG + Intronic
1175186168 20:57180799-57180821 GGTGTCCTGGGGCCCCCGGATGG - Intronic
1175256641 20:57652030-57652052 GGTCCCCAGGGGGGCCGGGCTGG - Exonic
1175465839 20:59191085-59191107 GGCCACCTGGGGCCCCTGGAGGG - Exonic
1175635668 20:60580621-60580643 GGTCTCCACGGGTCCCAGGAGGG - Intergenic
1175925408 20:62468894-62468916 GGTCACCCAGGGCCCCCAGATGG + Intronic
1175979096 20:62728071-62728093 GGTCATAAGGAGCCCCAGGAGGG - Intronic
1176000773 20:62830380-62830402 GGACACCAGGGGCTCCGGGAGGG - Exonic
1176028771 20:63000155-63000177 TGTCCCCAGGGGCCCCGGGTGGG + Intergenic
1176039398 20:63056355-63056377 TGTGACCACGGGCCCAGGGAAGG - Intergenic
1176086748 20:63298907-63298929 GGGCACCGGGGCACCCGGGACGG - Intronic
1176107483 20:63396247-63396269 GGTCACCAGGGGTCCCTGAGGGG - Intergenic
1176313467 21:5218714-5218736 GGTTGCCAGGGGCTCAGGGAGGG + Intergenic
1177754201 21:25324903-25324925 GGTTGCCAGGGGCTCGGGGAAGG + Intergenic
1178403430 21:32306236-32306258 GGACTCCTGGGCCCCCGGGAGGG - Intronic
1179339286 21:40489335-40489357 AGTCAGCAGGGGACCCAGGAAGG - Intronic
1179614384 21:42572286-42572308 TGCCACCAGGTGCCCCAGGACGG - Intronic
1179916456 21:44481049-44481071 GGTAACCAGGAGCCCTGAGAGGG - Intergenic
1180464976 22:15603154-15603176 GGTGCCCAGGGGCCTCTGGAGGG + Intergenic
1180930806 22:19589834-19589856 GGTTACCAGGGGCTAGGGGAGGG - Intergenic
1181162076 22:20965216-20965238 GGGGACCAGGGTCCCCGGGGCGG - Intronic
1181162254 22:20965774-20965796 GGGCGCCAGGAGCCCTGGGAGGG + Intronic
1182426701 22:30277250-30277272 GGTCGCCAGGGGCCGGGGGAGGG + Intergenic
1182520396 22:30881585-30881607 GGTTCCCAGGGGCCCAGGGAGGG - Intronic
1183067851 22:35375846-35375868 GGGCAACTGGGGCCCCTGGAGGG + Intergenic
1183714421 22:39525385-39525407 AGTGACCAGGGGCCCGGGGCTGG + Intergenic
1184179341 22:42809533-42809555 GGTGACCAGGGGCCAGGGGCAGG + Intronic
1184265222 22:43342931-43342953 GGTGGGCCGGGGCCCCGGGAGGG - Intronic
1184420579 22:44380755-44380777 GGTCACACGGGGCCCTGGGAGGG + Intergenic
1184455931 22:44609425-44609447 TGTCCCCAGGGGCCCAAGGAAGG - Intergenic
1184779166 22:46637743-46637765 GGTGCCCAGGGGCCCCAGGATGG - Intronic
1184824970 22:46943713-46943735 GGTCACCAGGGGCTGAGGAAAGG - Intronic
1184921538 22:47608933-47608955 GGTCACCAGGGGCTAGGGTAGGG + Intergenic
1185267916 22:49914282-49914304 GGTGGACAGGGGCCCCGGGAGGG + Intronic
1185294275 22:50045686-50045708 AGAGGCCAGGGGCCCCGGGAGGG - Intronic
1185340032 22:50287080-50287102 GGCCACCCGGGGGCTCGGGAAGG + Intronic
950021705 3:9792410-9792432 CGGCCCCAGGGGCCGCGGGAGGG + Exonic
950583799 3:13879417-13879439 GGTCCGAAGGGTCCCCGGGATGG + Intronic
950736676 3:15014655-15014677 GGTCACCAGGGGCTGGGGGAGGG - Intronic
952415712 3:33089732-33089754 GGTCACCAGGGGCTGGAGGAAGG + Intronic
952955636 3:38555650-38555672 GCTCACCAGGGGCCGTGGGATGG + Exonic
952977288 3:38707273-38707295 GCTCACCAGGGGCCGTGGGATGG + Exonic
954390942 3:50267642-50267664 GGTCCCCAGCGGCCCCAGGGTGG + Intronic
954712842 3:52513486-52513508 TGTCACCACGGGCCCTGGGGAGG + Intronic
955919268 3:63938176-63938198 GTTGACCAGGTTCCCCGGGAAGG + Intronic
955932860 3:64075295-64075317 GGTCACCAGGGGCTGGGGGTGGG + Intergenic
957062445 3:75492983-75493005 GGTTTCCAGGGGCTGCGGGAGGG - Intergenic
957674942 3:83354375-83354397 GGTCACAAGGGGCTCAGTGAGGG + Intergenic
959204535 3:103288480-103288502 GGTCACCAGGGGCAGGGGGTGGG - Intergenic
960054875 3:113270033-113270055 GGTCCACAGGTGCCCTGGGATGG - Intronic
965783357 3:172311415-172311437 TGTCACCAGAGGCCCTTGGAAGG + Intronic
966693001 3:182760699-182760721 GGGCACCAGGGGCCTGCGGAGGG + Intergenic
968442359 4:630302-630324 GGCCACGAGGGGCAGCGGGAGGG + Intronic
968483713 4:848883-848905 GAGGACCAGGGGCCCCTGGAAGG - Intergenic
968661489 4:1800559-1800581 GGTCTCCAGGAGGCCTGGGAGGG + Intronic
968904839 4:3446385-3446407 GGTCAGCAGAGGCACCGGGATGG - Intronic
968904849 4:3446408-3446430 GGTTACCGGGGACCCCGGGAAGG - Intronic
969279806 4:6162134-6162156 GGTCAGCAGGGCCTCAGGGAAGG + Intronic
969702965 4:8777804-8777826 GGTCAGCTTGGGCCCAGGGAGGG - Intergenic
972717148 4:41657847-41657869 GGTCCCCAGGAGCCCTAGGAAGG + Intronic
977666715 4:99652317-99652339 GGCCACCAAAGGCCCCGGCAAGG - Exonic
981782681 4:148444918-148444940 GGCCACCCAGGGCCCGGGGAGGG - Intergenic
982134598 4:152261956-152261978 GGTTACCAGGGGCCGCAGGGTGG + Intergenic
984441897 4:179781305-179781327 GGTTACCAGGGGCTCTCGGAGGG - Intergenic
985433676 4:189906574-189906596 GGTTGCCAGGGGCTCAGGGAGGG - Intergenic
985532596 5:442960-442982 GGTCGCCAGGGGCAGCGAGAGGG + Exonic
985576912 5:677853-677875 GGACGCCAGGGCCACCGGGAGGG - Exonic
987556297 5:19455427-19455449 GGTTACCAGGGTTCCAGGGAGGG + Intergenic
989420012 5:41226616-41226638 GGTTAGCAGGGGCCGCAGGAGGG - Intronic
989480601 5:41925725-41925747 GGTCCCCAGGGGCCCCATGAAGG - Intronic
992164590 5:74036945-74036967 GGTCACCAGGGGTTGGGGGAAGG + Intergenic
997418354 5:133747013-133747035 GGCCACCAGGGGCACTGTGAGGG + Intergenic
1000627310 5:163553886-163553908 GGTCACCAGGGGCCGGGGGAAGG - Intergenic
1002376204 5:178790729-178790751 CGTCATCAGGGGCCCTGGGTTGG - Intergenic
1003900637 6:10652092-10652114 AGTCACCATGGGCCACGGGTTGG + Intergenic
1004200621 6:13544403-13544425 GGTCACCAGGGGCTTGGGGAGGG - Intergenic
1004690460 6:17988058-17988080 TGCCACCCGGAGCCCCGGGACGG + Intergenic
1006124850 6:31830918-31830940 GGTCACCAAGGGCTGTGGGATGG + Intergenic
1007234162 6:40378538-40378560 GGGCAGCAGCGGCCCTGGGAAGG - Intergenic
1007323676 6:41044231-41044253 CGGCACCAGGGGACCCAGGAGGG - Exonic
1008103435 6:47417233-47417255 GGTCACCAGGGGCTGAGAGAAGG - Intergenic
1008840087 6:55892429-55892451 GGTTTCCAGGGGCTCGGGGATGG + Intergenic
1009889669 6:69665647-69665669 GGTTACCAGGGGCCAAGGGGTGG - Intergenic
1010225613 6:73486386-73486408 GGTTACCAGGGGCTGGGGGAAGG - Intronic
1012823074 6:104113070-104113092 GGTCACCAGAGGCTGGGGGAGGG + Intergenic
1013005331 6:106067698-106067720 GGTTACCAGGGGCCGGGGAAAGG + Intergenic
1013316880 6:108951705-108951727 CGACGCCAGGGGCCCCGTGAGGG - Intronic
1014852794 6:126362071-126362093 GGTCGACAGGGGCCCTGGGAGGG + Intergenic
1017775177 6:157675106-157675128 GCTCCCCAGAGGCCCCAGGAAGG + Exonic
1017935282 6:158999835-158999857 GGTCCCCAGGTTTCCCGGGAAGG + Exonic
1018845722 6:167553877-167553899 GGCCTCCTGTGGCCCCGGGAAGG - Intergenic
1019134568 6:169899964-169899986 GGCCACCAGGGTCCCTGGGGAGG - Intergenic
1019485948 7:1289233-1289255 GGTGACCAGGGCCCCCGGGTGGG - Intergenic
1019500329 7:1361299-1361321 GGTGACCTGGGGCCCCAGGAGGG + Intergenic
1019508495 7:1405327-1405349 GGTCACCCGGGGCCCTGGGTGGG - Intergenic
1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG + Intronic
1020109418 7:5439772-5439794 GGACCCCAGGAGCCCCAGGAAGG - Intronic
1020224847 7:6272282-6272304 GGTCTCCGGGGGCCGAGGGAGGG - Intronic
1020257363 7:6509557-6509579 GGTCACCAGGGGTCCCAGCTGGG + Intronic
1021204880 7:17768136-17768158 GTTTACCAGGGGCTGCGGGAAGG - Intergenic
1021266932 7:18536223-18536245 GGTGACCAGAGGTCCCTGGAAGG + Intronic
1021407960 7:20295795-20295817 GGTTGCCAGGGGCTGCGGGAAGG - Intergenic
1022267394 7:28770769-28770791 GGTTACCAGGGGCAGGGGGATGG + Intronic
1022468566 7:30667364-30667386 GGGCACCAGGGAGCCAGGGAGGG - Intronic
1023029279 7:36078847-36078869 GGTCCCCGGGGGCCCTGGGGTGG - Intergenic
1024053580 7:45645630-45645652 GGTAACCACGGGACCCTGGAAGG + Intronic
1025020968 7:55478960-55478982 GGGCAGCAGGGGCCCATGGAAGG + Intronic
1026358252 7:69578828-69578850 GGTTACCAGGGGCTGAGGGAGGG + Intergenic
1026792929 7:73346485-73346507 GGGCCCAAGGGGCCCCAGGAGGG + Intronic
1028224313 7:88232269-88232291 GGTTACCAGGGGCTGGGGGAGGG + Intergenic
1029364843 7:100110109-100110131 GGTCACCAGGGTCTCCCAGATGG + Intronic
1032037703 7:128531851-128531873 GGCCAAAAGGGTCCCCGGGACGG - Intergenic
1032487437 7:132298377-132298399 GCTCACCAAGGGCCTCAGGATGG + Intronic
1033534447 7:142298983-142299005 GGTCACCCGGGGCACAGGCAGGG - Intergenic
1034466433 7:151232639-151232661 GGTCTCCCGGCGTCCCGGGAGGG - Exonic
1035063118 7:156084098-156084120 GCTTACCAGGGGCCAGGGGATGG - Intergenic
1035265970 7:157690530-157690552 GGTAACCAGGGGTGCCGGGCGGG - Intronic
1035309887 7:157960159-157960181 GGGTACCAGGGGCCGGGGGAGGG + Intronic
1035850958 8:2919007-2919029 GCTCTCCAGGGGCCCAGGGAGGG + Intergenic
1036019298 8:4825504-4825526 GTTTACCAGGGGCCAGGGGAAGG - Intronic
1036212102 8:6850618-6850640 GGAGACCAGGGGCCCAGGGCAGG + Intergenic
1036262171 8:7249645-7249667 GGTCACAAGGGGGACGGGGACGG - Intergenic
1036304419 8:7589913-7589935 GGTCACAAGGGGGGCGGGGACGG + Intergenic
1036314210 8:7708184-7708206 GGTCACAAGGGGGACGGGGACGG - Intergenic
1036355271 8:8037905-8037927 GGTCACAAGGGGGGCGGGGACGG + Intergenic
1036596386 8:10216581-10216603 GGTTACCAGGGGCTGGGGGAAGG - Intronic
1036654037 8:10664064-10664086 TCTCTCCAGGGACCCCGGGATGG + Intronic
1036784487 8:11677071-11677093 GGTCACCAGGAGGGCCAGGAGGG - Intronic
1036951089 8:13140060-13140082 GGTTACCAGGGGCTGGGGGAAGG - Intronic
1037015165 8:13895898-13895920 GGTTACCAGGGACCAGGGGAAGG - Intergenic
1037426406 8:18760405-18760427 GGTTACCAGGGGTCTGGGGATGG - Intronic
1037843571 8:22262955-22262977 AGGCCCCAGGGGCCCCAGGAGGG - Intergenic
1037855341 8:22367419-22367441 GGACGCCAAGGGCCGCGGGATGG + Intronic
1038022714 8:23563576-23563598 GGGCCCCAGGGTCCCAGGGAGGG - Intronic
1041085011 8:54248650-54248672 GGTTACCAGGGGCTGGGGGAAGG + Intergenic
1044964755 8:97564085-97564107 GGTTGCCAGGGGCTCAGGGAGGG + Intergenic
1045220849 8:100198794-100198816 GGTTGCCAGGGGCCAGGGGAAGG - Intronic
1046454546 8:114440917-114440939 GCTAAGCATGGGCCCCGGGAGGG - Intergenic
1046871332 8:119208522-119208544 GGTGACCCGGGGCGGCGGGAAGG - Exonic
1048861207 8:138725416-138725438 GGACACCAGGGGGTCCTGGAGGG + Exonic
1049256040 8:141614412-141614434 GGTCACCCTGGGCCCCGGGGAGG - Intergenic
1049321956 8:142001373-142001395 TATCACCAGGGGACACGGGAAGG + Intergenic
1049608062 8:143538882-143538904 AGTGACCAAAGGCCCCGGGAAGG - Exonic
1049914683 9:305914-305936 GGTCGCCAGGGGCTGGGGGAGGG + Intronic
1050278767 9:4028610-4028632 GGGCACAAGGGGCTCCTGGAAGG - Intronic
1053722794 9:40964700-40964722 GGTTGCCAGGGGCTCAGGGAGGG - Intergenic
1054769517 9:69070441-69070463 GGCCACCAGGGCCACCAGGAGGG + Intronic
1056746780 9:89310515-89310537 GGGCGCCAGGAGCCCCGCGACGG + Intergenic
1057223067 9:93268175-93268197 GGTGACCAGGGGCCCCAGTCTGG + Intronic
1057234312 9:93346438-93346460 GGCCACGAGGGGCGCGGGGAGGG + Intergenic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1059456268 9:114402209-114402231 GGTCCCCAGGGGCATGGGGAGGG + Exonic
1060045998 9:120341415-120341437 GGTTACCAGGGGCTGAGGGAAGG + Intergenic
1060358397 9:122931625-122931647 GGACAACAGGGGCCCCGAGAGGG + Intergenic
1061152647 9:128837647-128837669 GGTCCGCAGGGGGCCAGGGAAGG + Intronic
1061880605 9:133567068-133567090 TGCCACCAGGGGCCCTGGGCAGG + Intronic
1062123594 9:134847773-134847795 GGTGACCAGGGCCACTGGGAAGG + Intergenic
1062198853 9:135289956-135289978 GGTCACCTAGGGCCCAGGGGAGG - Intergenic
1062394768 9:136348330-136348352 GGTGACCAGGGGCCACAGGAAGG + Intronic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic
1062536580 9:137023716-137023738 GGCCGGCAGGGGGCCCGGGAGGG + Intronic
1062722207 9:138050369-138050391 GGGCAGCAAGGGCTCCGGGAGGG + Intronic
1203452367 Un_GL000219v1:131280-131302 GGTTGCCAGGGGCTCAGGGAGGG + Intergenic
1185507822 X:643028-643050 GGACACCTGGTGACCCGGGAGGG + Intronic
1185802306 X:3024095-3024117 GGCCACCTGGAGCCCCTGGACGG + Exonic
1187144658 X:16626411-16626433 GGTTGCCAGGGGCCAGGGGAAGG + Intronic
1187452175 X:19408190-19408212 GGTCACATGGGTCCCGGGGAGGG + Intronic
1187647374 X:21363299-21363321 GGTTACCAGGGGCTGGGGGAAGG - Intergenic
1188995286 X:36877490-36877512 GGTTACCAGGGGCTTTGGGAGGG + Intergenic
1189833029 X:44994254-44994276 GGTTACCAGAGGCTCAGGGAGGG - Intronic
1197941613 X:131795863-131795885 GGTCTCCTGGGTCCCCTGGAGGG + Intergenic
1198193789 X:134339063-134339085 GGTTACCAGGAGCCAGGGGAAGG + Intergenic
1198368069 X:135963109-135963131 GGTTGCCAGGGGCTCGGGGATGG + Exonic
1199996736 X:153030693-153030715 GGTCATCTGGGTCACCGGGAAGG - Intergenic
1200003734 X:153074454-153074476 GGTCATCTGGGTCACCGGGAAGG - Exonic
1200149659 X:153944907-153944929 CTACACCAGGGGCCCCGGCAGGG + Intergenic
1200314181 X:155114429-155114451 GGTCACCAGGGGCCGGGAGAAGG + Intronic