ID: 1090191918

View in Genome Browser
Species Human (GRCh38)
Location 11:124777223-124777245
Sequence TTGGAAGGGTGAAAGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 1, 2: 4, 3: 45, 4: 438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090191918_1090191925 -5 Left 1090191918 11:124777223-124777245 CCATGTCCCTTTCACCCTTCCAA 0: 1
1: 1
2: 4
3: 45
4: 438
Right 1090191925 11:124777241-124777263 TCCAAGGCCATAAATGGAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090191918 Original CRISPR TTGGAAGGGTGAAAGGGACA TGG (reversed) Intronic
901412288 1:9092922-9092944 TTGGAAGGGCTAAAGGCAAAAGG - Intergenic
902359765 1:15935990-15936012 CAGGAAGGGGGACAGGGACAGGG - Exonic
903179319 1:21597456-21597478 ATGGGAGTGTGAAAGGGACTTGG - Intronic
903630951 1:24770266-24770288 GAGGAAGGGAGAAAGGGAGAGGG - Intronic
904607546 1:31705960-31705982 GTGGAAGGGAGGAAGGGGCATGG - Intergenic
905415434 1:37800547-37800569 TTGGAAGGGTGTCAGGGTCTGGG + Exonic
905504322 1:38465227-38465249 TTGGAAGTGTGTAAGGGATTCGG - Intergenic
905677480 1:39837850-39837872 TGGGAAGGGGAAAAGGAACAGGG - Intergenic
905977299 1:42185809-42185831 GTGGAAGGGGGAAGGGGAGAAGG - Intronic
906609992 1:47194830-47194852 ATGGAAAGGTGAAAGGGGCAAGG + Intergenic
907172157 1:52478463-52478485 TTAGAAGAGTGAATGGTACATGG - Intronic
907303477 1:53501996-53502018 TGGGAGGGGTGGGAGGGACAAGG + Intergenic
907383812 1:54112596-54112618 TGGGAAGGGGAAGAGGGACATGG - Intergenic
907693368 1:56694637-56694659 TTCACATGGTGAAAGGGACAAGG + Intronic
907722445 1:56984404-56984426 TTGGAAGGGAGAAAAGGAGAGGG + Intergenic
908170974 1:61504428-61504450 TTGTAAGGGTTAGAGGTACAGGG - Intergenic
908743784 1:67355777-67355799 TTTGAAAGGTGACAGGGAGAAGG + Intronic
909641314 1:77871087-77871109 TGGGAAGGGGGAGAGGGAGAGGG + Intronic
910166020 1:84328446-84328468 ATGGAAGGGTGATTGGGTCAGGG + Intronic
912366362 1:109137044-109137066 TTTGAGGGGTGAAGGGGACCAGG + Intronic
914989014 1:152482301-152482323 AAGGAAGGGTAAAAGGGAAAAGG - Intergenic
915007938 1:152657427-152657449 CTGTAAGAGTGAAAAGGACAAGG - Intergenic
915528200 1:156488931-156488953 GTGGAAGGGTGTAGGGGAGAAGG - Intronic
915779806 1:158534916-158534938 GTGAAACGGTGAAAGGGAGACGG - Intergenic
916323171 1:163528585-163528607 TGGGAAGGGTGAAAAGAAGAGGG + Intergenic
918197685 1:182237652-182237674 TTGGAAGAATGAGAGGGACTGGG - Intergenic
918257528 1:182762916-182762938 TTGGAAGGGTTAAAAGGAATGGG - Intergenic
918290065 1:183098968-183098990 TTGGAAGGGTTACAGGGCCAAGG - Intronic
918475556 1:184920528-184920550 TGGGAAGGGTGAAGGGAATAGGG - Intronic
919083848 1:192897034-192897056 TTGGAAGAGTGAAGGGGAGATGG + Intergenic
920209767 1:204319832-204319854 AGAGAAGGGAGAAAGGGACAGGG + Intronic
921164114 1:212493887-212493909 GTGGAATGGTGAGAAGGACATGG + Intergenic
922081975 1:222306196-222306218 CTTGAAGGGGGAAAGGGAAAAGG + Intergenic
922218208 1:223538140-223538162 CTGGAAGGGTAGAAGGGACTAGG + Intronic
922367622 1:224880820-224880842 TTTGAAGGGTGAGAAGGGCAGGG - Intergenic
923274806 1:232386686-232386708 TTGGAGGGGTGAAAAGAACCGGG + Intergenic
923669281 1:236026150-236026172 TGGGAAGGATGGAGGGGACAAGG + Intronic
923871596 1:238000514-238000536 TGGTAAGGGTTAAAGGGAAAAGG + Intergenic
924419023 1:243889876-243889898 TAGGAAGTGTGAAAAGGGCAGGG - Intergenic
1063773565 10:9232786-9232808 ATGGAACAGTGAAAGGGACAAGG - Intergenic
1064550284 10:16493666-16493688 ATGGAAGGAAGAAAGGGAAAGGG + Intronic
1065327113 10:24559092-24559114 GTGGAAATGTGACAGGGACAGGG - Intergenic
1065759287 10:28966896-28966918 TTGGGAGGGAGGAGGGGACAGGG - Intergenic
1069075196 10:64031895-64031917 TTTGAAGGGTGAGAAGGGCAGGG + Intergenic
1071586645 10:86829396-86829418 AGGGAAAGGTGAAAGGCACAAGG - Intronic
1072701463 10:97644661-97644683 TTGGAAGAAGGAAAGGGAGAGGG + Intronic
1072801877 10:98397738-98397760 TGGGAGTGGTGACAGGGACAAGG + Intronic
1073164054 10:101428143-101428165 TTGGCAGGATGACAGGGAGAAGG + Intronic
1073183711 10:101602425-101602447 TTGGCAGGGTTAAGAGGACAGGG + Intronic
1073276471 10:102315828-102315850 CTGGAAAGCAGAAAGGGACAAGG - Intronic
1073439544 10:103544385-103544407 GTGGAAGGGGGAATGGGAGAAGG + Intronic
1073560235 10:104489995-104490017 TGGGCAAGGTGATAGGGACAGGG + Intergenic
1073718229 10:106134055-106134077 TTTGATGGGAGAAAGTGACAGGG + Intergenic
1073746158 10:106470573-106470595 TTGGAAGGGTGCAAGTGTCCAGG - Intergenic
1074791222 10:116889514-116889536 GTGGAAGGTGGAAAGGGACTAGG + Intronic
1075231760 10:120685909-120685931 TTGAGAGGGTGAAAATGACAAGG - Intergenic
1075658145 10:124175253-124175275 TTCCAAGGGTGACAGGGACATGG + Intergenic
1075687899 10:124376843-124376865 TTTGAATGGTGAATGGGCCAAGG - Intergenic
1076067896 10:127463705-127463727 CAGGAAGGGAGAAAAGGACATGG - Intergenic
1076250233 10:128979264-128979286 TTGGAAGGGTGCATGCGCCATGG + Intergenic
1077377180 11:2210578-2210600 TTGGAAAGTGGAAAGGGAAATGG + Intergenic
1077446318 11:2592654-2592676 TTGGCAGTGTCAAAGGGACTGGG + Intronic
1078391702 11:10940512-10940534 TTGGAAGGGAGACAGGGTAAAGG - Intergenic
1079288716 11:19165945-19165967 ATGGAAGGAAGAAAGAGACAGGG + Intronic
1079532735 11:21474610-21474632 TTGGTGCAGTGAAAGGGACAGGG - Intronic
1079769088 11:24435983-24436005 AAGCAATGGTGAAAGGGACATGG - Intergenic
1081640914 11:44753580-44753602 TTCGAATGGAGAAAGAGACAGGG - Intronic
1081736951 11:45410922-45410944 TGGGAGGGGTGATAAGGACAAGG - Intergenic
1082581292 11:54872724-54872746 TTGGAAGGGTGTATGTGTCAAGG - Intergenic
1083196721 11:61092555-61092577 CCGGAGGGGTGAAAGGGGCAGGG + Intergenic
1083345119 11:61984085-61984107 GTGCAAGAGTGAAAGGGCCAGGG + Intergenic
1083464898 11:62838988-62839010 TTGAATGGGTGACAGGGACCTGG - Intronic
1084434228 11:69129312-69129334 TGGGAAGGGTGACGGGGAGAGGG + Intergenic
1084713673 11:70860090-70860112 TGTGAAGGGAGCAAGGGACAGGG - Intronic
1084885566 11:72203770-72203792 TGGGGAGGGAGCAAGGGACAGGG + Intergenic
1086103171 11:83122616-83122638 TTTGAAGGAGGTAAGGGACATGG - Intergenic
1087542770 11:99542315-99542337 TTGGGAGGGTGTAAGGGAGGAGG - Intronic
1087623133 11:100565216-100565238 TTGGAATGCTGAAAGGGAGGTGG - Intergenic
1087625431 11:100590178-100590200 TTGGAAGGGTGTATGTGTCAAGG + Intergenic
1087809529 11:102595215-102595237 TGGCAAGGGTGGAATGGACATGG - Intronic
1087826410 11:102769227-102769249 AGGGAAGGGTGGTAGGGACAGGG - Intergenic
1089269928 11:117295116-117295138 TTGCCAGGGTGAGAGGAACAGGG - Exonic
1089672974 11:120069264-120069286 TGGGAAGGGTGAAGGGGAAGAGG - Intergenic
1089800688 11:121024403-121024425 GGGGAAGGGTGAAAGCCACATGG + Intronic
1090191918 11:124777223-124777245 TTGGAAGGGTGAAAGGGACATGG - Intronic
1090196667 11:124822321-124822343 TTTGAAGGGTGAGAAGGGCAGGG - Intergenic
1090295470 11:125583987-125584009 GTGGAAGGGTAAATGGCACAGGG - Exonic
1091006141 11:131955677-131955699 CTGGGAGGGTGGGAGGGACATGG - Intronic
1091481711 12:839217-839239 TTGGAAGTAGGAAAAGGACAAGG + Intronic
1091780676 12:3212866-3212888 TGAGAAGGGTGAAAAGGAGAGGG + Intronic
1092210828 12:6645441-6645463 TAGGCAGGGATAAAGGGACATGG + Intronic
1092830407 12:12439215-12439237 TTTGAAGGGTGATAGGGTTAGGG + Intronic
1092984116 12:13828704-13828726 TTGGAAGGGGGAAAAGAAAATGG - Intronic
1094530974 12:31274483-31274505 CTGGAAGGGGGAAGGTGACAAGG + Intergenic
1096961754 12:55585970-55585992 TTGGAAGGAGTAGAGGGACATGG - Intergenic
1098022524 12:66170546-66170568 GTGGATGGGTGACTGGGACATGG - Intergenic
1098071038 12:66674999-66675021 TTGTTAGTGGGAAAGGGACAGGG + Intronic
1100084450 12:90892057-90892079 TTGGAGGAGTGAAAGGGAGAGGG - Intergenic
1101270498 12:103138743-103138765 TTGGAAGGGTCAAAGGAAAGAGG - Intergenic
1101672169 12:106885731-106885753 TAGGAAAGATGAAAGGGGCATGG - Intronic
1101829187 12:108243856-108243878 TTGGGAGGGTGACAAGGGCATGG - Intronic
1102478169 12:113202208-113202230 GTGGCAGGCTGAAAGAGACAAGG + Intronic
1102625635 12:114233264-114233286 TTGGAAGGGAGAAGGGGAAGGGG - Intergenic
1102723286 12:115035966-115035988 TTGGAAGAGTGAATGGGAAATGG + Intergenic
1103045217 12:117730486-117730508 GTGGAAGGGGGAGAGGGAGAGGG - Intronic
1103147957 12:118611570-118611592 TTGGAAGCCTGAAAGGGCCGGGG + Intergenic
1103527861 12:121579551-121579573 TTGGAAGGGGGAGAGGCAGACGG + Intronic
1105211196 13:18258145-18258167 ATGGATGGGTGAAAGGGAGAGGG - Intergenic
1105281875 13:18969061-18969083 TTGGAAGGTAGAAAGGAACATGG - Intergenic
1107705578 13:43100452-43100474 TTGGGAGGGTGAGGGGGGCACGG - Intronic
1109396226 13:61763478-61763500 TAGGAAGGGTGAAAGGAAGCAGG + Intergenic
1109865911 13:68262298-68262320 TTTGAAGGCTTAAATGGACAAGG - Intergenic
1110324086 13:74194083-74194105 TTGGAAGGAAGAATGGGAGAAGG + Intergenic
1110508143 13:76314539-76314561 TTCGAAAGGTGAGAAGGACAGGG + Intergenic
1112412614 13:99177232-99177254 AGGGAAGGGGGAAAGGGAAAGGG - Intergenic
1114572659 14:23684423-23684445 TTGGAAAGGTGCAAGGGTGAAGG + Intergenic
1114650226 14:24280038-24280060 TTGGATGGATGAATGGGACAGGG - Intergenic
1115622749 14:35156379-35156401 TTGGAAGGGTGGAATGCATATGG + Intronic
1115993290 14:39171098-39171120 TTAGTGGGGTGCAAGGGACAAGG + Intergenic
1116472368 14:45300776-45300798 TTAAAAGGGGGAGAGGGACATGG - Intergenic
1116544058 14:46140749-46140771 TTGGAAGGGTAAAAGGAGGAGGG - Intergenic
1116669098 14:47817980-47818002 GGGGAAGGATGAAAGGGAGAAGG - Intergenic
1116857558 14:49966482-49966504 TCAGGAGGGTGAAAGGGCCAGGG - Intergenic
1117003616 14:51395904-51395926 TTGGAAGAGAGAAAGAGAAAAGG - Intergenic
1117057383 14:51926792-51926814 TTTGAAGGGTGAGAAGGACAGGG - Intronic
1117198329 14:53363075-53363097 TTGGAAGGGTGAAAGGGCCAGGG - Intergenic
1117834249 14:59785792-59785814 ATGGAAGGGTGGAAAGGGCAGGG - Intronic
1118245034 14:64101979-64102001 TTGGAAGCATGACAAGGACATGG + Exonic
1118504155 14:66392235-66392257 GTGCAAAGGTGATAGGGACAAGG + Intergenic
1118890656 14:69905731-69905753 GTGGAAGGGTGAAGGTGAAAGGG + Intronic
1118918261 14:70126668-70126690 TGGGAAGGGTGGGAGGAACATGG - Intronic
1120137907 14:80891547-80891569 TTGGAAGGGTGAGGAGGAGATGG + Intronic
1120210760 14:81631282-81631304 TTGGCAGGGAGAAAAGGAGAAGG + Intergenic
1121088366 14:91163870-91163892 TTGTAGGAGAGAAAGGGACATGG + Intronic
1122357755 14:101134180-101134202 CTGGAAGCGTGGAAGGCACAAGG + Intergenic
1122421040 14:101577547-101577569 CTGGAAGGGCCACAGGGACAGGG + Intergenic
1122881665 14:104693103-104693125 TTTGCAGGGTCAGAGGGACATGG + Intronic
1122915232 14:104855323-104855345 GTGGAGGGGTGAAAGGAGCAGGG + Intergenic
1126337992 15:47607453-47607475 TAGGTAGGTGGAAAGGGACAAGG - Intronic
1126885325 15:53142766-53142788 TTGGAAGGATGGAAGAGAAAGGG - Intergenic
1127274877 15:57433650-57433672 GGGGAAGGGAGACAGGGACAGGG - Intronic
1127343639 15:58071490-58071512 TTAGAAGGGTAAAAGGAAAAAGG - Intronic
1127773581 15:62249102-62249124 CAGTAAGGGTGGAAGGGACAGGG + Intergenic
1128843464 15:70869746-70869768 TTGGAAGCATAACAGGGACAAGG - Intronic
1129044866 15:72725739-72725761 GGGGAAGGGGGAAAGGGAAAGGG - Intronic
1129781757 15:78276871-78276893 GGGGAAGGGGGAGAGGGACACGG - Intronic
1130112498 15:80977268-80977290 TTAGAAGTATGAAAGGGGCAGGG - Exonic
1130120246 15:81041747-81041769 TTGTATGGCTCAAAGGGACAAGG + Intronic
1130710296 15:86273836-86273858 ATAGAAGGGTGAAAGGAAAAAGG + Intronic
1130833361 15:87625724-87625746 TTGGAAGATGGAAAGGGAGAAGG - Intergenic
1131952586 15:97696845-97696867 TTGTCAGGGTGTAAGGCACAGGG - Intergenic
1133027024 16:2992974-2992996 TGGGCAGGGAGACAGGGACAGGG - Intergenic
1133855577 16:9546432-9546454 ATGGAAGGTAGAGAGGGACATGG + Intergenic
1134352092 16:13447183-13447205 ATGAAAATGTGAAAGGGACAGGG - Intergenic
1134502044 16:14776898-14776920 GAGGAAGGCTGCAAGGGACATGG + Intronic
1134572899 16:15306843-15306865 TGGGGAGGGTCCAAGGGACATGG - Intergenic
1134578517 16:15351995-15352017 GAGGAAGGCTGCAAGGGACATGG - Intergenic
1134724071 16:16405549-16405571 GAGGAAGGCTGCAAGGGACATGG + Intergenic
1134729485 16:16449139-16449161 TGGGGAGGGTCCAAGGGACATGG + Intergenic
1134937950 16:18262711-18262733 TGGGGAGGGTCCAAGGGACATGG - Intergenic
1134943358 16:18306320-18306342 GAGGAAGGCTGCAAGGGACATGG - Intergenic
1135239450 16:20791029-20791051 CGGGAAGAGTGAGAGGGACAGGG + Intronic
1135526622 16:23217954-23217976 CTGGAAGGGTGAAGTGGAGAAGG - Intergenic
1136287930 16:29254911-29254933 TTGGGAGGGAGAAGGGGAGATGG - Intergenic
1137650320 16:50114469-50114491 TTGGAAGGCAGGAAGGGACAGGG - Intergenic
1139307057 16:65995647-65995669 TTGAAAGAATGAATGGGACATGG + Intergenic
1139966847 16:70750506-70750528 TTGGTGGAGTGAAAGGGTCAGGG + Intronic
1140160463 16:72486389-72486411 ATGGAAGGCAGAAAAGGACAAGG - Intergenic
1140248876 16:73276905-73276927 TTGGAAGGTAGAAAGGAACATGG - Intergenic
1141172849 16:81702041-81702063 ATGGAAGGGTCTAAGGGACATGG - Intronic
1141749388 16:85948116-85948138 TTGGAAGGGGGAACTGGTCAAGG + Intergenic
1141937813 16:87253549-87253571 TTGGCAGGGTGAAAGGGAACAGG + Intronic
1142093588 16:88227628-88227650 TTGGGAGGGAGAAGGGGAGACGG - Intergenic
1143178466 17:4969781-4969803 TTGGATGGGGTAAAGGGTCAGGG - Intronic
1143732440 17:8888692-8888714 CTGGGAGGATGCAAGGGACAAGG + Exonic
1144108325 17:12007385-12007407 GTGGAAGGTTTAAAGGGACATGG - Intergenic
1144219380 17:13086215-13086237 TTGGAAGGGTGAAGGAGGCTGGG - Intergenic
1144308143 17:13988034-13988056 TTGAATGAGTGAATGGGACATGG - Intergenic
1144724131 17:17493091-17493113 GTGCAAGGCTGAAATGGACAAGG + Exonic
1144915313 17:18719502-18719524 TTGGAAGTAGGAAAGTGACAGGG + Intronic
1145184500 17:20782612-20782634 TTGGGAGGGGGGAGGGGACAGGG + Intergenic
1145253338 17:21308800-21308822 CTGGAAGGGAGACAGGGAGATGG - Intronic
1145323239 17:21779129-21779151 ATGGAAGGGAGACAGGGAGATGG + Intergenic
1146584180 17:34068229-34068251 ATGGAAGGAAGAAAAGGACAGGG + Intronic
1146682189 17:34816283-34816305 TGGGAAGGGTGCAAGTGACGAGG + Intergenic
1147032543 17:37651509-37651531 GTGGAAGAGACAAAGGGACAAGG + Intergenic
1147693546 17:42333856-42333878 TTAGATGAGGGAAAGGGACAAGG + Intronic
1148117854 17:45187983-45188005 AAGGAAGGGAGAAAGGGAGAAGG - Intergenic
1148411880 17:47474438-47474460 TTGGGAGGGGGGAGGGGACAGGG - Intergenic
1148876320 17:50689581-50689603 TGGGAAGGGTGCCATGGACAGGG + Intronic
1148892657 17:50819380-50819402 TTGGAAGGTAGAAAGAGGCAGGG + Intergenic
1149107604 17:52988135-52988157 TTTGAAGGGTGAGAAGGGCAGGG - Intergenic
1150595764 17:66603000-66603022 TTTGAAGGGTGAGAAGGACAGGG - Intronic
1150784957 17:68154804-68154826 AAGGAAGGGGGAAAGGGAAAGGG - Intergenic
1151191209 17:72399468-72399490 TTGGAGGGGTGAGAAGGGCAAGG - Intergenic
1151296162 17:73187731-73187753 TGGAAAGGGTGAAAGCGAGAAGG - Intergenic
1152753621 17:82077848-82077870 CTGGGAGGGAGCAAGGGACAGGG - Intergenic
1152870500 17:82751120-82751142 GGGGAAGGGGGACAGGGACAGGG - Exonic
1153001793 18:462505-462527 ATGGAAGGGTGAAAGGGAGTTGG + Intronic
1153782084 18:8503900-8503922 TTCGCTGGGTGAAAGGGACAAGG - Intergenic
1156439861 18:37174078-37174100 TTGGCAAGGTGCTAGGGACATGG - Intronic
1156541355 18:37914174-37914196 GTGGAAGGATGAGAGGGATATGG + Intergenic
1156701235 18:39827948-39827970 TTGGAAAGGTCAATGAGACAAGG + Intergenic
1157639703 18:49202195-49202217 GTAGAAGAGTGAAAGGGACTAGG - Intronic
1158484572 18:57854320-57854342 TTTGAAGGCTAAATGGGACATGG - Intergenic
1159882663 18:73873968-73873990 TTGGAAGGGTAAAAGGTTTAGGG + Intergenic
1161936377 19:7374946-7374968 TTGGAAGGGGTTGAGGGACACGG - Intronic
1162567168 19:11450883-11450905 TAGGAGGGGTGGCAGGGACAGGG - Exonic
1163007184 19:14404424-14404446 CTGGAAGAGTGACAGCGACAGGG + Exonic
1165429578 19:35764947-35764969 TAGGAAGGGTGATGGGGGCAGGG - Intronic
1166203883 19:41256425-41256447 TTGGATTGGGGAAAGGAACAGGG - Intronic
1166329781 19:42071125-42071147 TGGGAAAGGTGGATGGGACAAGG + Intronic
1166571243 19:43798424-43798446 CTGGAAGGGTGGAAGGGCCTGGG - Intronic
1166656484 19:44615724-44615746 CTGGAAGGAGGAAAGGGACGTGG + Intronic
1167515058 19:49918481-49918503 TAGGGAGGGAGGAAGGGACAGGG + Intronic
1167573245 19:50303940-50303962 TTGGAAGAGTGAAAGGTATTAGG - Intronic
1167640387 19:50678519-50678541 GTGGAAGGGTCAGAGTGACAGGG + Intronic
1168294066 19:55370268-55370290 TGGGGAGGGTGGAGGGGACAGGG - Intronic
925178667 2:1802375-1802397 TGGGAAGTGGGAGAGGGACATGG + Intronic
926829149 2:16941359-16941381 TTTGAAGGGTGAGAAGGACAGGG - Intergenic
927021522 2:19021916-19021938 TGGGTAGGGAGAAAGGGAAAAGG - Intergenic
927813209 2:26191925-26191947 CTGGGAGGGTGAAGGGGCCAAGG + Intronic
927960329 2:27237312-27237334 TAGGAAGGGTGAGCTGGACATGG - Intronic
929326498 2:40617995-40618017 TTGGAAGGGAGAAAGTGAGAGGG - Intergenic
929426085 2:41846086-41846108 TGGGAAGGGGCAAAGGGAAAGGG - Intergenic
930902143 2:56520707-56520729 TTGGCATGGTGGAAGGGACAAGG + Intergenic
931296082 2:60927216-60927238 AAGGAAGGGTGAAATTGACATGG + Exonic
931374462 2:61695013-61695035 TTGGAGGGGAGAAAGGGGCGGGG + Intergenic
931873828 2:66490555-66490577 TTGTAAGTGTCAAAGGGAAAGGG + Intronic
931970052 2:67576109-67576131 TTAGGAAGGGGAAAGGGACAGGG + Intergenic
931994664 2:67828473-67828495 TTGGATGGGTGAAATGTCCAAGG - Intergenic
932475031 2:72000093-72000115 TTTGAGGTGTGAAAAGGACAGGG + Intergenic
932918905 2:75887318-75887340 TTGGAAGGGGGTAGGGGAGAAGG - Intergenic
933099220 2:78230426-78230448 TTGATTGGGTGAAAGGGAAAAGG - Intergenic
933380611 2:81539032-81539054 TTGGAAGGTTAAAATGGAGAAGG - Intergenic
933501090 2:83112424-83112446 TGGGGATGCTGAAAGGGACATGG - Intergenic
933817722 2:86081512-86081534 TAGGAGAGGTGAAAGGGCCAAGG - Intronic
935141389 2:100355959-100355981 TGGGGAGGGGGAAGGGGACAGGG - Intergenic
935463716 2:103369208-103369230 TTGGAAGGGTGAACTGAAAATGG - Intergenic
935617208 2:105098795-105098817 TTGGAAGAGTGAAAAAGACAAGG + Intronic
935914481 2:107934815-107934837 GTTAAAAGGTGAAAGGGACAGGG + Intergenic
936427800 2:112435036-112435058 TTGGCAGGGTGGAGGGGGCAGGG - Intergenic
938064476 2:128273598-128273620 TTGGCAGAGGGAAGGGGACAAGG - Intronic
938274561 2:130006381-130006403 TGGAAAGGGTGAAAGGGTAAGGG - Intergenic
938440806 2:131330891-131330913 TGGAAAGGGTGAAAGGGTAAGGG + Intronic
939346626 2:140974595-140974617 TTAGAAGGGAGAAAGGAAGAAGG + Intronic
939548704 2:143586931-143586953 TTGGAGGGAGGAAAGGGAGAGGG - Intronic
943560663 2:189457896-189457918 TTGGCAGGGTAAAAGGGAAGAGG - Intronic
944104638 2:196066704-196066726 GTGGAAGGTTGAGAGTGACATGG - Intronic
944353370 2:198756681-198756703 TGGGAATGGAGCAAGGGACAGGG - Intergenic
944404381 2:199366169-199366191 TAGGGAGGCTGAGAGGGACATGG + Intronic
944610610 2:201401958-201401980 CTTGAAGTGTGAAAAGGACAGGG + Intronic
944970552 2:204987924-204987946 TTAGAAGGCTGGAAGGGAAAGGG + Intronic
945217273 2:207447021-207447043 TTTGAAGGGTGAGAAGGGCAGGG - Intergenic
945631920 2:212288648-212288670 TTTGAAGGGTGACCAGGACAGGG - Intronic
945860487 2:215115844-215115866 TTAGAAGGGTGAAGAGGACATGG + Intronic
946174145 2:217912380-217912402 TTGGAGGGTGGAAAGGGGCAGGG - Intronic
947532917 2:230924120-230924142 TGATAAAGGTGAAAGGGACATGG - Intronic
947553626 2:231067613-231067635 TTGGAAGGGGGAACGAGGCAGGG - Intronic
948295285 2:236856026-236856048 TTGCAAAGGTGAGCGGGACACGG - Intergenic
948412869 2:237778330-237778352 TTGGAGGGGTGACAAGAACAGGG - Intronic
1169767407 20:9162256-9162278 TTGCAAGGTTGAAAGGATCAAGG + Intronic
1170683468 20:18547553-18547575 GTGCAGGGGAGAAAGGGACAAGG - Intronic
1170929731 20:20758163-20758185 TGGGAAAGCAGAAAGGGACAGGG + Intergenic
1171407889 20:24925158-24925180 TTGGGAGGGTGTAAGTGTCAAGG - Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1172777285 20:37415071-37415093 TGGGAAGGGAGAAGAGGACAAGG - Intergenic
1172781949 20:37441928-37441950 GGAGAAGGGTGAAAGGGACAGGG + Intergenic
1173177817 20:40777722-40777744 GGGGAAGGGTGAGAGGGGCAGGG + Intergenic
1173211374 20:41035298-41035320 TGGGAAGGGTAGAAGGGAGATGG - Intronic
1173693636 20:44986831-44986853 TTGGAAGGATCAGAGGGAGAGGG + Intronic
1173712413 20:45171552-45171574 CTGGATGGGTGAGAAGGACACGG - Intergenic
1174192513 20:48750285-48750307 TTGGGAGGGTGAAGGGGACCAGG - Intronic
1174396917 20:50252284-50252306 TAGGGAGAGTGAAAGGGAGAGGG + Intergenic
1174535941 20:51251553-51251575 TTTGAAGGGTGAGACGGGCAGGG - Intergenic
1175934549 20:62509061-62509083 ATGGAGGGGTGAAAGGGTGAGGG - Intergenic
1176374444 21:6080175-6080197 TTGGCAGGGTGGAGGGGGCAGGG + Intergenic
1177254003 21:18635763-18635785 TTGGAAGGGTGTACGGGTCCAGG - Intergenic
1178597556 21:33968376-33968398 TGGAAAGGGGGAAAGGGACTGGG + Intergenic
1178621883 21:34184490-34184512 ATGGAACTGTGTAAGGGACAAGG - Intergenic
1179749031 21:43458070-43458092 TTGGCAGGGTGGAGGGGGCAGGG - Intergenic
1180765040 22:18341292-18341314 ATGGATGGGTGAAAGGGAGAGGG + Intergenic
1180813989 22:18778392-18778414 ATGGATGGGTGAAAGGGAGAGGG - Intergenic
1180894734 22:19321948-19321970 GTGGAATGGTGAAAGGGAAGTGG + Intergenic
1181200174 22:21212727-21212749 ATGGATGGGTGAAAGGGAGAGGG - Intronic
1181701563 22:24624232-24624254 ATGGATGGGTGAAAGGGAGAGGG + Intronic
1182400679 22:30074491-30074513 ATGGAAGGGAGAAAGAGACTTGG - Intergenic
1183278630 22:36919161-36919183 TTGCCAGGAGGAAAGGGACACGG + Intronic
1184409826 22:44320045-44320067 ATGGAAGGAAGAAAGGGACGGGG - Intergenic
1185308361 22:50136658-50136680 TTGGAAGGGTGGGGAGGACAAGG + Intronic
1203226662 22_KI270731v1_random:82197-82219 ATGGATGGGTGAAAGGGAGAGGG + Intergenic
1203264088 22_KI270734v1_random:4079-4101 ATGGATGGGTGAAAGGGAGAGGG - Intergenic
949498953 3:4660281-4660303 TTGGAAGTGAAAATGGGACAAGG - Intronic
950206074 3:11082159-11082181 CAGGAAGGGAGAAAGGGACTGGG - Intergenic
951544560 3:23811035-23811057 TCTGAGGGGTGAAAGGGGCAAGG + Intronic
952671111 3:35970460-35970482 TTAGAAGGGTCAAGGTGACAGGG - Intergenic
953205752 3:40827419-40827441 TTGGAAGGAGGAGGGGGACAGGG - Intergenic
954452375 3:50578725-50578747 GTGGCATGGTGAGAGGGACATGG + Intronic
955343804 3:58146091-58146113 TTTGGAGGGTGAAGTGGACACGG + Intronic
955700816 3:61680314-61680336 GTGGAGGTGTGAAAGGGAGAGGG + Intronic
956543766 3:70375523-70375545 TTGGGAGGGGGTAAGGGCCAGGG + Intergenic
957026374 3:75187061-75187083 TTTGAAGGATGAAAGGGAGCTGG - Intergenic
958013695 3:87914059-87914081 GTGGAAGTGGGAAAGGGAGATGG + Intergenic
958653121 3:96963423-96963445 TTGGAAAGGTGAAAAGAAGAGGG - Intronic
958742563 3:98092796-98092818 TTGGGAGGGTGTATGTGACAAGG + Intergenic
958974653 3:100653953-100653975 TTTGAAGGGTGAAAAGGACAGGG + Intronic
960213408 3:114999130-114999152 GAGGAAGGGGGAAAGGGAGAGGG + Intronic
960963554 3:123089391-123089413 TAGGGAGGGTCCAAGGGACATGG + Intronic
961015629 3:123466020-123466042 TTGAATGGGAGAAAGGGATAGGG + Intergenic
962849292 3:139295853-139295875 ATGGAAAGGTGGAAGGGAGAAGG - Intronic
963652869 3:148006338-148006360 TTGGAATGGTGAGAGGGAAGTGG + Intergenic
963882820 3:150547026-150547048 ATGGATGGGTGAAAGGGAGGGGG - Exonic
964262217 3:154852287-154852309 ATGGAAGACTGAAAGAGACATGG + Intergenic
964902822 3:161680656-161680678 TTGGAAGGGTTGAAAGGATAGGG - Intergenic
965775363 3:172224583-172224605 TCAGCAGGGGGAAAGGGACAGGG - Intronic
965884088 3:173423310-173423332 TTTGAAATGTGAAAAGGACATGG - Intronic
966781608 3:183589018-183589040 TGGGGAGGTAGAAAGGGACAGGG + Intergenic
967148555 3:186627196-186627218 TGGGAAGGGTGAAGTGGTCAGGG - Intergenic
967839309 3:193992012-193992034 GTGGAGGGGGGAAAGGGGCAGGG + Intergenic
967863536 3:194171754-194171776 TAGGAAGGGGAAAAGGGAGATGG + Intergenic
968201538 3:196760120-196760142 TTGTATGGGTGAAAGAGACAGGG + Intronic
969069515 4:4523931-4523953 TGGGAGGGGTTAAAGGGAGAGGG - Intronic
969081440 4:4621581-4621603 TTGGAATGTTGAATGGGAGAAGG + Intergenic
969277040 4:6142861-6142883 ATGGAAAGGTTTAAGGGACATGG + Intronic
969726285 4:8920316-8920338 TTGGAACGGTGGGAAGGACAAGG - Intergenic
970371040 4:15406816-15406838 TTTAAAGGGGGAAAGAGACAGGG + Intronic
971101929 4:23476438-23476460 TTGGAAGGTGGAAAAGGAAATGG + Intergenic
971644939 4:29187609-29187631 TAGCAAGGGTCAAAGGGACCTGG - Intergenic
972010356 4:34172134-34172156 CAGGAAGGGGGTAAGGGACAGGG - Intergenic
972049799 4:34715353-34715375 AGGGAAGGGAGAAAGGGAGAGGG - Intergenic
972573949 4:40334947-40334969 TTTGAAGAGGGAAAGAGACACGG - Intergenic
972995168 4:44870348-44870370 TTGGAAGGGACCAGGGGACAAGG + Intergenic
973029388 4:45316593-45316615 GTGGAAGGGTGAAGGGGATGGGG + Intergenic
973927038 4:55749081-55749103 CTGGAAGGGGGAAAGGGGGAGGG + Intergenic
974131606 4:57763000-57763022 TGAGAAGGGAGAAAAGGACAGGG + Intergenic
975301602 4:72797282-72797304 TTTTAAATGTGAAAGGGACATGG - Intergenic
976675966 4:87703795-87703817 TTGGAAGGGAGAAAAGCAGAAGG + Intergenic
976981891 4:91242242-91242264 TTGGAAGGGAGTAATGAACAAGG + Intronic
977249725 4:94676372-94676394 TTGGAAGGGTGAAGGGCTAAGGG - Intergenic
978257791 4:106713103-106713125 TTGGGAGGGTGTAAGTGACCAGG + Intergenic
979822240 4:125189269-125189291 TGTGAAGGGTTAAAGGGTCAAGG + Intergenic
980290486 4:130843842-130843864 TCAGAAAGGTGAAAGGGAAAAGG - Intergenic
980483042 4:133414308-133414330 CTCGCATGGTGAAAGGGACAAGG - Intergenic
980885410 4:138757387-138757409 TTGGAAGGGAGGAAAGGAGAAGG - Intergenic
980919941 4:139074243-139074265 TGGGAAGGGAGGAAGGGTCAGGG + Intronic
981881169 4:149614542-149614564 TTGCAATGGTGATAGGGCCAAGG - Intergenic
982993007 4:162303107-162303129 TTGGAAAGGAGAAAGCGCCAAGG - Intergenic
984633954 4:182091340-182091362 TTGCAAGGGTGAAAGGGCAAAGG + Intergenic
985282200 4:188298624-188298646 ATGGAAGTGTGAAAGAGATAAGG - Intergenic
985358171 4:189143505-189143527 TAGGAAGAGTGAAATGGACAAGG + Intergenic
986265541 5:6187087-6187109 TTGGATGGAAGAAAGGCACAGGG - Intergenic
986393018 5:7302638-7302660 CAGTAAGGGTGGAAGGGACAGGG + Intergenic
986647112 5:9928324-9928346 ATGCCAGGGAGAAAGGGACATGG - Intergenic
987207016 5:15638322-15638344 TCAGAAGTGTGAAAGGGCCAGGG + Intronic
987239588 5:15981533-15981555 AGGGAAGGGTGAAGGGGATAAGG - Intergenic
988266427 5:28957036-28957058 TTGGAAATATGAAAGGGAGACGG - Intergenic
990572662 5:57094777-57094799 GTGGAAGTGGGAAAGGGAGATGG + Intergenic
991428817 5:66521727-66521749 TTGGAAGGCAACAAGGGACATGG + Intergenic
991942095 5:71863093-71863115 ATGGAAGGAGGAAAGGAACAGGG - Intergenic
992742409 5:79787197-79787219 TGGGAAGGGGAAAAGTGACAAGG - Intronic
994137329 5:96302899-96302921 TTGGAAGTGGGTAAGGGGCAGGG - Intergenic
995424292 5:112003046-112003068 TGGGAAGGGATAAAGGGACTTGG + Intergenic
995758772 5:115543048-115543070 TTGGAAGTGTCAAACCGACATGG - Exonic
996384594 5:122897866-122897888 TTGAAGGGGTGAACAGGACAGGG - Intronic
996930882 5:128885422-128885444 ATGGAAGGGGGAGATGGACAAGG + Intronic
998969150 5:147572256-147572278 TTGGAGGGGAGAAGGGGACTAGG + Intergenic
999266631 5:150270884-150270906 ATGGGAGGGTGGAAGGGCCATGG - Intronic
999940231 5:156534370-156534392 TTGGAAGGGAGAAAGGCTGAGGG - Intronic
1000103617 5:158038055-158038077 TTTGAAATGTGAAAAGGACATGG + Intergenic
1000292450 5:159883156-159883178 TTGGAAGGGGGAAAAAGAGAAGG - Intergenic
1000379271 5:160614452-160614474 TGGGAAGGGAGAAAGGGATCAGG + Intronic
1002154902 5:177269578-177269600 TGGGAAAGGTGAAAAGGAGAAGG - Intronic
1002969589 6:2000443-2000465 TGGGGAGGGTTGAAGGGACAGGG - Intronic
1004011757 6:11695433-11695455 TTGACAAGGAGAAAGGGACATGG + Intergenic
1006060800 6:31417421-31417443 TGGGAAGAGTGAAAGGGAACAGG - Intergenic
1006557870 6:34884407-34884429 ATGGAAGGGTGAAGGGTATATGG + Intronic
1006868147 6:37225873-37225895 CAGGAAGGGGGAAAGGGAGAAGG - Intronic
1007399122 6:41593810-41593832 TTGGAAGGGAGAGAGGGAGAGGG + Intronic
1008439234 6:51513840-51513862 TTGAAAGGGTTAAAGTGAAAAGG + Intergenic
1008494453 6:52118501-52118523 TTTGAAGGGAGAAAGGGTCTAGG - Intergenic
1008942256 6:57059903-57059925 TAGGAGAGGTGAAAGAGACAGGG - Intergenic
1010067527 6:71701877-71701899 TTAGAAGGGTGACAGGGAGGTGG + Intergenic
1010522798 6:76861555-76861577 GTGGAAGGGTGAAAGGGAGATGG + Intergenic
1010983731 6:82398700-82398722 GTGAAAGGGTGCAAGGGGCAAGG + Intergenic
1011017246 6:82770581-82770603 ATGGAAGAGAGTAAGGGACAAGG + Intergenic
1011147700 6:84236921-84236943 TTGGGAGGGTGTAAGGGTCCAGG - Intergenic
1012071184 6:94618845-94618867 AGGGAAGGGGGAAAGGGAAAGGG - Intergenic
1012505943 6:99946470-99946492 TTAGAAGGGTGAAAGAGGCAGGG + Intronic
1012795225 6:103750949-103750971 TTTGAAGGGTGAATAGGGCAGGG - Intergenic
1014256086 6:119161092-119161114 TTGGAATGGTGACAGGCATATGG + Intergenic
1014406111 6:121053160-121053182 TTGGAAATGTGTAAGTGACAGGG + Intergenic
1016299997 6:142619907-142619929 TTGTAAGGGTGATGGGGACAGGG + Intergenic
1016312750 6:142751899-142751921 GTGGAAGGGGGAAAAGGAGATGG - Exonic
1016632660 6:146250228-146250250 TTTGAAATGTGAAAAGGACATGG + Intronic
1017423204 6:154294724-154294746 TTTGAAGGGTGAGAAGGGCAGGG - Intronic
1017662811 6:156690445-156690467 TTCCAAGGATGAAAAGGACATGG - Intergenic
1018875536 6:167819261-167819283 ATGGGAGGGAGAAAGGGGCAAGG - Intergenic
1020599239 7:10251253-10251275 TTGGAAGGGTGTATGTGCCAAGG - Intergenic
1021315813 7:19145588-19145610 ATGGAAGACTCAAAGGGACAGGG + Intergenic
1021952750 7:25791111-25791133 TTGGCAGAGTGAATGGAACATGG + Intergenic
1022327428 7:29344827-29344849 TTGGAAGGCTGCATGGGGCAGGG - Intronic
1022418546 7:30198752-30198774 TTGGAAGAGAGAAAGGGAAAGGG + Intergenic
1022434682 7:30371624-30371646 TTGGATGGGGGAAAGCCACAAGG + Intronic
1023858800 7:44203958-44203980 TACAAAGGGTGAAAGGGAGAAGG - Intronic
1024326147 7:48110664-48110686 TTTTAAAGGTAAAAGGGACAGGG + Intergenic
1026259769 7:68744890-68744912 TTGGGAGGGTGAATGGGTTAAGG + Intergenic
1026488765 7:70845396-70845418 TAGGAAGGGAGAAAGTGAGAAGG + Intergenic
1026685234 7:72504217-72504239 TGGGAAGGATGAAAGACACATGG - Intergenic
1027802151 7:82767992-82768014 AGGGAAGGGAGAAAGAGACAGGG + Intronic
1028603347 7:92627460-92627482 TTCATATGGTGAAAGGGACAAGG - Intronic
1028858161 7:95615936-95615958 TTGGGAGGGTGAATGGGTCCAGG - Intergenic
1029597374 7:101545092-101545114 TTGGGAGGGTGAGGGGGGCAGGG - Intronic
1029944784 7:104520672-104520694 TTGGAAGGGTGTATGTGTCAAGG + Intronic
1030294349 7:107906581-107906603 ATGGAAGGGTGGAAGGTACAAGG - Intronic
1030759588 7:113334049-113334071 TTGGGAGGGTGTAAGTGTCAAGG - Intergenic
1032124176 7:129180028-129180050 GTGGCAGTGTGAAGGGGACAAGG + Intergenic
1032302360 7:130699466-130699488 TTGGAATGGTGAGAGGATCAAGG - Intergenic
1033168954 7:139066496-139066518 TACAAAGGGTGGAAGGGACAAGG + Intronic
1033493381 7:141867275-141867297 TAGCAAGGCTGAAAGAGACAAGG + Intergenic
1033495685 7:141892261-141892283 TAGTAAGGCTGAAAGAGACAAGG + Intergenic
1034749601 7:153556325-153556347 TTTGAAGGGAGGAAGGGTCAAGG - Intergenic
1035157556 7:156926317-156926339 GTGGAATGGTCAGAGGGACAAGG - Intergenic
1035837256 8:2767695-2767717 CTGGAAACGTGAAAGGGGCAAGG - Intergenic
1036128773 8:6088497-6088519 TTGGGAGGGTGTATGGGTCAAGG + Intergenic
1036604136 8:10291669-10291691 TTTGAAGGGAGAAAGGGGCGAGG - Intronic
1036777274 8:11622330-11622352 TAGGAGGGCTGAAAGGGGCAGGG - Intergenic
1037210299 8:16378008-16378030 TTGGAAGAGTGAAAGGGAGAAGG + Intronic
1037662286 8:20938403-20938425 TAGGAAGGGTGAATGTGCCAAGG - Intergenic
1037798232 8:22014844-22014866 TTGGAAGGGGGAGAGGAGCAAGG + Intergenic
1037993758 8:23338649-23338671 TAGGAAGAGGGAAAGGGACATGG + Intronic
1038651446 8:29407544-29407566 AGGGAAGGGAGAAAGGGAGAAGG - Intergenic
1039818982 8:41119555-41119577 GAGGAAGGGGGAAAGGGAGAGGG - Intergenic
1040858029 8:51970374-51970396 CTGGCAGGGGGTAAGGGACAGGG - Intergenic
1040981955 8:53252881-53252903 TTGAAAGGGTTGAAGGGATATGG - Intergenic
1041167890 8:55108922-55108944 TGGGAGGGGTGAAAGCAACATGG + Intronic
1041257970 8:55995673-55995695 TAGGTCGGGTGAAAGGGGCAGGG + Intronic
1041837347 8:62231315-62231337 TTCCAAGGTTGAAAGGTACAGGG + Intergenic
1042398709 8:68320880-68320902 GAGGAAGGGTGAAGGGGACAGGG - Intronic
1042411082 8:68466218-68466240 TGGGAAGGGTGATTGGGGCATGG + Intronic
1042998019 8:74722172-74722194 TTGAGGGGGTGGAAGGGACAGGG - Intronic
1043318339 8:78949214-78949236 TTGGTAGGGTGTATGGGACTAGG - Intergenic
1043999339 8:86859501-86859523 TTGGAAGGGTGGAAGGGAAATGG + Intergenic
1045571458 8:103372124-103372146 TGGGAAGGGTGGGAGGGATAGGG + Intronic
1046292837 8:112185291-112185313 TTGGGAGGGTGTATGGGCCAAGG - Intergenic
1047250676 8:123180003-123180025 TTGGAATGGTGGAAAGTACATGG + Exonic
1049564658 8:143331864-143331886 GTGGAAGGGTGGAAGAGGCAGGG + Intronic
1050862585 9:10453752-10453774 TTGGAAGGGAAGAAGGTACATGG - Intronic
1050999650 9:12265386-12265408 CGGGAATGGTGAAAGGGAGAGGG + Intergenic
1051727804 9:20106114-20106136 TTGGGAGGGTGTAAGTGTCAAGG - Intergenic
1054745156 9:68846674-68846696 TTAGAAGGAAGAAAGGGGCAGGG - Intronic
1055877575 9:80961832-80961854 TTTGAAGGGTGAGAAGGACAGGG - Intergenic
1057179083 9:93020166-93020188 TTGGTAGGGGGGAAGGGAGATGG + Intronic
1058400319 9:104609796-104609818 TTGGAAAGGTGAAAGGAGAAAGG - Intergenic
1058662597 9:107280686-107280708 TTTGAGGGTTGAAAGGGAAATGG + Intergenic
1060971706 9:127742077-127742099 TTGTAAGGGTCAATGGGATAAGG + Intronic
1061063686 9:128264179-128264201 TGGTAAGGGTGGAAGGAACAGGG + Intronic
1061238011 9:129353221-129353243 TTGGGAGGGAGGGAGGGACAGGG - Intergenic
1061264521 9:129497402-129497424 TTGGAGGAGTGGAAGGCACAAGG + Intergenic
1185844163 X:3421612-3421634 TGGGAAGGATGAGAGGGTCAGGG + Intergenic
1186392907 X:9179329-9179351 TTGGATCTGTGAAGGGGACAAGG - Intergenic
1187323838 X:18268142-18268164 ATGGAAGAGAGAAAGGGAGATGG - Intronic
1187375310 X:18747334-18747356 TTGGAAGGGAGAAAGGGTGTGGG + Intronic
1188582922 X:31737291-31737313 TAGGAATGGATAAAGGGACAGGG + Intronic
1190304694 X:49075318-49075340 TGGGCAGGGGGACAGGGACACGG + Intronic
1190385319 X:49878754-49878776 TGGGAAGGGAGACAGGGACGAGG + Intergenic
1191691052 X:63938686-63938708 TTGGAAGGGTGTATGTGTCAAGG - Intergenic
1191968892 X:66791767-66791789 TTGGAAGGGTGTATGTGTCAAGG + Intergenic
1192047348 X:67689946-67689968 TGGGAAGGAGGAAAGGGTCAGGG - Intronic
1192075544 X:67992154-67992176 TTGGAAGGGTGTATGTGTCACGG - Intergenic
1192350419 X:70351299-70351321 TTGGAAGAGTGAAAGGGTTGGGG - Intronic
1192819052 X:74624038-74624060 GTGGAAGGGAGAAAGGAAGAAGG - Intergenic
1193359287 X:80561543-80561565 TTGGACCTGGGAAAGGGACAGGG - Intergenic
1194131649 X:90089069-90089091 TTTGAAGGGTGAGAAGGCCAGGG + Intergenic
1195033384 X:100948412-100948434 TTTGAAAGGTGGAAAGGACAAGG + Intergenic
1195129825 X:101840962-101840984 TTAGAGGGGTGGAAGGGATAAGG - Intronic
1195176411 X:102318861-102318883 TTAGAGGGGTGGAAGGGATAAGG + Intronic
1195182453 X:102368232-102368254 TTAGAGGGGTGGAAGGGATAAGG - Intronic
1195768968 X:108328375-108328397 GTGGAAGGGGGAGAGGGAAAGGG + Intronic
1196385378 X:115142987-115143009 TTGGAAGGCTGAAAGGTGAAAGG + Intronic
1196505184 X:116433983-116434005 TTGAATGGGTGAAAGAGAGAGGG - Intergenic
1196874451 X:120144653-120144675 TTGGGAGGGAAAAAGGAACAAGG + Intergenic
1197066803 X:122243025-122243047 TTGGATTGGTGAAATGGAAACGG - Intergenic
1197392515 X:125884495-125884517 TTTGAAATGTGAAAGGGACATGG + Intergenic
1197732730 X:129825673-129825695 TTGGAAGGGAGGAGGGGACTAGG - Intronic
1197762171 X:130035773-130035795 TTGGAGGGGCCAATGGGACAGGG + Intronic
1198706716 X:139457095-139457117 TTGGAGAGGTGTATGGGACAAGG - Intergenic
1198739975 X:139831895-139831917 TGGGTAGGGTGAAAGTGAAAGGG - Intronic
1199388268 X:147248565-147248587 TCGGAAGGGTGAAAAGGATCTGG - Intergenic
1199675597 X:150186610-150186632 ATGGAATGGTGAAAGGGAAGAGG + Intergenic