ID: 1090193396

View in Genome Browser
Species Human (GRCh38)
Location 11:124793516-124793538
Sequence GTGGCTAGTGACTGTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090193396 Original CRISPR GTGGCTAGTGACTGTTTTGT TGG (reversed) Intronic
901655935 1:10769288-10769310 GTGGCCAGTGGCTGCTGTGTGGG - Intronic
902327249 1:15709487-15709509 GTGGCTAGTGACTACTGTATTGG + Intronic
902856358 1:19209350-19209372 TTAGCTAGTGACAGTTATGTAGG - Intronic
904075838 1:27841613-27841635 ATGGCTAGTGGCTGCTATGTTGG + Intronic
906512514 1:46418662-46418684 GTGGCTACTGCCTGTTTTCATGG + Intergenic
907328671 1:53657449-53657471 GTGGCCTGTGACTGCTTTGGCGG + Intronic
907382973 1:54106594-54106616 GTGGCTAGTGGCTACTGTGTTGG + Intronic
907940291 1:59081014-59081036 ATGGCTAGTGACTAGTGTGTTGG - Intergenic
907976694 1:59437543-59437565 GGGTCTAGTGACTGCTTTGGGGG + Intronic
909099676 1:71334622-71334644 GTGTCTAGTGACAGTGCTGTGGG - Intergenic
909652842 1:77995028-77995050 GTGGCTAGTGGCTACTGTGTTGG - Intronic
910462355 1:87461359-87461381 GTGCCTAGTGATGTTTTTGTAGG + Intergenic
911888441 1:103334675-103334697 ATGGATAGTGACTGTTTAATGGG - Intergenic
912327012 1:108775540-108775562 GTGGTGGGTGACTGTTTAGTGGG - Intronic
912392937 1:109317390-109317412 GTGGCTAGTGACTATCATATTGG + Intronic
913309139 1:117468525-117468547 GTGGCTAGTGACTACTGTATTGG - Intronic
914949003 1:152094357-152094379 GTGGCTAGTGACTACCTTATTGG + Intergenic
915192458 1:154163190-154163212 GTGGCTAGTGGCTATTATATTGG - Intronic
916080460 1:161228961-161228983 GTGGATAGTAACTGGTGTGTAGG + Exonic
918024662 1:180731830-180731852 GTAGCTAGTGGCTGTTGTATTGG + Intronic
918297814 1:183173795-183173817 GTGGCTAGTGACTACTGTATTGG - Intergenic
918304938 1:183237222-183237244 ATGGCTAGTGACTATTTTCTTGG + Intronic
918333916 1:183488581-183488603 GTGGCTAGTGACTGCCATATTGG + Intronic
920586296 1:207165618-207165640 GATGCTGGTCACTGTTTTGTTGG + Intergenic
920597762 1:207290462-207290484 GTGGCTAGTGACTACTATGTAGG - Intergenic
920942644 1:210498615-210498637 GTGGCTACTGAAGGTGTTGTAGG + Intronic
921134258 1:212245927-212245949 ATGGGAAGTGACTGTTTTGTGGG + Intergenic
921947677 1:220897340-220897362 GTGGCTAGTGGCTGTCATATTGG + Intergenic
922324993 1:224519922-224519944 GTGGATAGTGACTACTCTGTTGG + Intronic
922954167 1:229585329-229585351 ATGGCTAGTGGCTATTTTGCTGG + Intergenic
923128251 1:231051468-231051490 GTGGATAGTGGCTGTCCTGTTGG - Intergenic
924121361 1:240802055-240802077 GTGGCTAGTGACTGCTGTACTGG + Intronic
924201488 1:241663668-241663690 GTGGCTAGTGGCCACTTTGTCGG - Intronic
1063346896 10:5319965-5319987 GTGTGTTGTGAATGTTTTGTAGG - Intergenic
1063852832 10:10212533-10212555 ATGGCTAGTGACTACTGTGTTGG - Intergenic
1064382168 10:14854798-14854820 GTGGCTAGTGGCTCTTTTATTGG - Intronic
1066611500 10:37253260-37253282 GTGGCTAGTGGCTATTGTATTGG - Intronic
1067916754 10:50408135-50408157 GTGGCTAGTGCCTATTGTATTGG + Intronic
1070281866 10:75055595-75055617 ATGGGGAGTGACTGTTTAGTGGG + Intronic
1071189938 10:83088811-83088833 GTGGCTAGTGACTATCATTTTGG + Intergenic
1072005123 10:91238197-91238219 GTGGCTAGTGACTTCTCTATTGG + Intronic
1072294602 10:93996750-93996772 GTGGCTAGTGACTACCATGTTGG - Intronic
1072792901 10:98331549-98331571 GTGGCAAGGGGCTGTTTTATGGG + Intergenic
1073563272 10:104515162-104515184 GTGGCTAGTGGCTGCCGTGTTGG - Intergenic
1074722654 10:116275895-116275917 ATGGCTAGTGACTATTGTATTGG - Intergenic
1074736312 10:116437735-116437757 GTGGCTAGTGGCTACTATGTTGG - Intronic
1075573743 10:123563484-123563506 GTGGCTTGGGACTGGTTTGCAGG + Intergenic
1076106379 10:127826922-127826944 GTGGCTAGTGACTATCATATTGG - Intergenic
1076217153 10:128704260-128704282 GTGGAGAGTGACTGTTTAATGGG - Intergenic
1078506700 11:11955548-11955570 GTGGCTAATGGCTGTTGTATTGG + Intronic
1079375681 11:19889644-19889666 GTGGCTAGCTACTCTTTTGATGG - Intronic
1079464687 11:20718319-20718341 GTGGCCAGTGGCTGCTTTATTGG + Intronic
1080730227 11:34943427-34943449 GTGGCTAGAGTCTGTTTTCTAGG + Intronic
1081424205 11:42907112-42907134 GAGGCTAGTAAGTGTTTAGTGGG - Intergenic
1081524749 11:43919481-43919503 GTAGCTAGTGACTATCTTATTGG + Intronic
1086703160 11:89922717-89922739 GTGGCTAGAGAAAGTTTTATTGG + Intergenic
1088128785 11:106461935-106461957 GTGGCTAGTGGCTACTGTGTAGG + Intergenic
1089034202 11:115368822-115368844 GTGGCTAGTGGCTATCATGTTGG - Intronic
1089773883 11:120822627-120822649 GTGGCTGGTGGCTGCTGTGTTGG + Intronic
1090193396 11:124793516-124793538 GTGGCTAGTGACTGTTTTGTTGG - Intronic
1090373642 11:126274195-126274217 CTGGCTTGTGAGTGTTCTGTTGG + Intronic
1090815650 11:130292333-130292355 GTGGATAGTGACTTTTTTTATGG - Intronic
1091561292 12:1615878-1615900 GTGGCTAGTGGCTATTGTTTTGG - Intronic
1093073435 12:14731931-14731953 GTGCCTAGTTACTGTCATGTGGG + Intergenic
1093106590 12:15094927-15094949 GTGGCTAGTGGCTGCTGTATTGG - Intergenic
1094430580 12:30365483-30365505 GTGGCTGGGTAGTGTTTTGTTGG - Intergenic
1094634317 12:32209850-32209872 ATGGCTAGTGACTACTATGTTGG - Intronic
1095770431 12:45949229-45949251 GTGGCTAGTGACTGTTGTCTTGG - Intronic
1095903739 12:47355919-47355941 GTGGCTAGTGGCTACTGTGTTGG + Intergenic
1095904141 12:47360182-47360204 GTGGCTAGTGGCTGCTGTGTAGG - Intergenic
1096728959 12:53590575-53590597 TTGCCTAGTGACAGTTTTATTGG - Intronic
1097831724 12:64231759-64231781 GTGGCTAGTGACTGCCATATTGG + Intergenic
1098849030 12:75572582-75572604 ATGACTAGTGACTATTTAGTAGG + Intergenic
1098858318 12:75679398-75679420 GTGGCTAGTGACTGCTATATTGG - Intergenic
1099035887 12:77586793-77586815 GTGACTAGTGGCTGTTATGTTGG + Intergenic
1100484918 12:95015827-95015849 GTTGATAGTGACTGTTTGCTGGG - Intergenic
1100640192 12:96475230-96475252 GTAGCTAGTGACTGTTGAATTGG + Intergenic
1101428974 12:104611355-104611377 GTGGCTTGTGACTGCTGTCTTGG + Intronic
1101514918 12:105425779-105425801 GTGGCTAGTGACTGTCATATTGG - Intergenic
1101588096 12:106102509-106102531 GTGGCTAGTGGCTTCTGTGTTGG + Intronic
1101612575 12:106304346-106304368 GTGGACAGTGACTGGCTTGTTGG + Intronic
1101728963 12:107410966-107410988 GTGGCTAGTGGCTGTTGTACTGG - Intronic
1102190960 12:110988056-110988078 GTGGGGAGTGACTGCTTAGTGGG - Intergenic
1102383493 12:112486962-112486984 GTAGCTGTTGACTGCTTTGTAGG + Intronic
1102562045 12:113769335-113769357 GTGTCTAGTGACTAGTCTGTAGG + Intergenic
1102895673 12:116596228-116596250 GGGGCTGGTGACTGTTTTCATGG + Intergenic
1105823328 13:24099358-24099380 GTGGCCAGTGACTAACTTGTTGG - Intronic
1107923996 13:45240412-45240434 GTAGCTAGTGTATGTTTTTTTGG + Intronic
1108452426 13:50580612-50580634 GTGGGGAGTGACTGCTTGGTGGG - Intronic
1111471827 13:88693910-88693932 CTGGCCAGTGCTTGTTTTGTAGG + Intergenic
1111887250 13:94037882-94037904 GTGGCTAGTGGCTGCTATGCTGG - Intronic
1114419314 14:22567584-22567606 GTGTCTAGTGGCTGTGGTGTTGG - Intronic
1115286597 14:31720781-31720803 GTGGCTAGTGGCTATTGTGTTGG + Intronic
1115786438 14:36831142-36831164 GTGGCTAGTGACTGCCATGTTGG - Intronic
1116825296 14:49667676-49667698 GTGGCTAGTGCCTGTAATCTTGG - Intronic
1117649261 14:57885677-57885699 GTGGCTAGTGGCTATTGAGTTGG + Intronic
1118180734 14:63490128-63490150 GTGGCTAGTGGCTGCTATATTGG - Intronic
1120480986 14:85048918-85048940 GTGGCTAGTGGCTGTCATGCTGG + Intergenic
1120784445 14:88519354-88519376 GTGGCTAGTGGCTGCTTTATTGG - Intronic
1120818884 14:88893560-88893582 GTGACAAGTGACTGCTTTGAGGG - Intergenic
1121586005 14:95063556-95063578 CTGACTTGTGACTGCTTTGTTGG - Intergenic
1121987531 14:98522330-98522352 GAGGCTAGTAAGTGTTGTGTGGG - Intergenic
1122057359 14:99111433-99111455 GTAATTAGTAACTGTTTTGTTGG - Intergenic
1125117522 15:36112713-36112735 GTGGCTAGTGGCTATTGTGTTGG - Intergenic
1125281710 15:38048549-38048571 GAGGCTGTTGGCTGTTTTGTGGG - Intergenic
1126711390 15:51460971-51460993 GTGGCTGGTGACTACTATGTTGG + Intronic
1127202352 15:56669489-56669511 GTGGCTAGTGGCTACTGTGTTGG - Intronic
1128471060 15:67953839-67953861 ATGGGTAGTGACTATTTTATTGG - Intergenic
1128663588 15:69521900-69521922 GTGGCTAGTGCCTGCTGTATAGG - Intergenic
1129610660 15:77053067-77053089 GTGGCTAGTGGCTGCTATATTGG - Intronic
1129942667 15:79512065-79512087 GGGCCTAGGGACTGTTTTGGAGG - Intergenic
1130003370 15:80067668-80067690 GTGGCTAGTGGCGATTGTGTTGG + Intronic
1130376286 15:83332135-83332157 GTGGCTAGTGACTACTATATCGG - Intergenic
1131372330 15:91893239-91893261 GTGGCCAGTGGCTGTCCTGTTGG + Intronic
1133290699 16:4718751-4718773 TTGGTTAGTGACTGCTTTGGGGG - Intronic
1133337234 16:5014201-5014223 GTGGCCAGTGGCTGGTGTGTTGG + Intronic
1135082796 16:19450776-19450798 GTGGCTAATGCCTGTGTTGGTGG + Intronic
1135284701 16:21183263-21183285 GTGGATAGTGACACTATTGTAGG + Intergenic
1135715005 16:24756265-24756287 GTGGCAAGTGGCTGTTGTTTTGG + Intronic
1136410760 16:30075838-30075860 GCGGCCAGTGGCAGTTTTGTGGG - Intergenic
1137746961 16:50829313-50829335 GTGGGAAGTGACTGGATTGTGGG + Intergenic
1138083331 16:54112459-54112481 GTGGCTAGTGACTGCTGTATTGG + Exonic
1138235972 16:55382990-55383012 ATGGCTAGTGTTTGTTTGGTGGG - Intergenic
1140198921 16:72878866-72878888 GTGGCTAGTGGCTGCTGTATTGG - Intronic
1140203217 16:72911620-72911642 GTGGCTAGTGGCTGCTATATTGG - Intronic
1140981115 16:80110425-80110447 GTGGTTAGTGGCTGCTGTGTTGG + Intergenic
1141070783 16:80952733-80952755 GTGGCTAGTGGCCATTATGTTGG - Intergenic
1141450186 16:84094222-84094244 GTGGTTTGTGAGTGTTTTGCAGG - Intronic
1143067127 17:4258779-4258801 GTGGCTAGTGACTATTGTGTTGG + Intronic
1144573304 17:16414314-16414336 GTGGCTAGTGACTATCTTATTGG + Intergenic
1144661837 17:17076008-17076030 GTGGGTGTTGCCTGTTTTGTGGG + Intronic
1146392531 17:32436199-32436221 GTGGCTAGTGACTATTATACTGG + Intergenic
1147648677 17:42049792-42049814 GTGGCCAGTGGCTGCTGTGTTGG - Intronic
1148380185 17:47190854-47190876 GTGGCTAGTGACTGCCATATTGG + Intergenic
1149047143 17:52259897-52259919 CTAGATACTGACTGTTTTGTAGG + Intergenic
1149734611 17:58980853-58980875 CAGGCTAGTGCCTATTTTGTGGG - Exonic
1150241268 17:63635147-63635169 GTGGCTAGTGGCTATTGTATTGG + Intronic
1151912281 17:77091615-77091637 GTGGCTAGTGGCTGCTGTGTTGG + Intronic
1154065917 18:11106822-11106844 ATGGCTTGGGACTGTTTTTTGGG + Intronic
1154494569 18:14946017-14946039 GTGGCTAGTGACTGCTACATTGG + Intergenic
1156916653 18:42469991-42470013 GTCCTTAGTGATTGTTTTGTGGG + Intergenic
1157658276 18:49414917-49414939 GTTGCTAGGGACTGTTTTTAAGG - Intronic
1158651188 18:59287742-59287764 GTGGGAAGTTACTGTTTAGTGGG + Intronic
1164659765 19:29953307-29953329 TTGGCTATTGACTGTTGTATTGG + Intronic
1164883462 19:31756816-31756838 GTGGCTAGTGACTATCATATTGG - Intergenic
1166085762 19:40473685-40473707 GTGGCTTGTGACTGCTGTATAGG + Intronic
1167044969 19:47044452-47044474 GTGGCCAGTGGCTGCTTCGTGGG + Intronic
1167225339 19:48235295-48235317 GTGGCTAGTGGCTGTCATATTGG - Intronic
925432438 2:3806864-3806886 GTTGCTCGTGACTGCTTTCTGGG + Intronic
926945079 2:18178624-18178646 TTGGTTAGAGACTGTGTTGTTGG - Intronic
927174206 2:20393924-20393946 GTGACTAGTTACTGTTAGGTTGG + Intergenic
927231322 2:20826713-20826735 GTGGGTAGTGTCTGGGTTGTGGG + Intergenic
928316662 2:30251798-30251820 GTGGTGAGTGGCTGCTTTGTTGG + Intronic
930365163 2:50430423-50430445 GTGGCGAATGACTATTGTGTGGG - Intronic
931712043 2:64996566-64996588 GTGGCTAGTGTCTATTGTATTGG - Intronic
932402023 2:71487259-71487281 GTGGCTAGTGGCTACTGTGTTGG + Intronic
933087068 2:78067518-78067540 GTGGCCAGTGACTGACCTGTGGG - Intergenic
933723243 2:85411347-85411369 GGGTCTAGTGACTGTGATGTAGG - Intronic
937000505 2:118462177-118462199 GAGGCTAGTGCATCTTTTGTTGG - Intergenic
938193950 2:129309471-129309493 GGTGGTAGTGACAGTTTTGTTGG + Intergenic
940778910 2:157912505-157912527 GTGGCTAGTGACTTTCATATTGG + Intronic
941384526 2:164837911-164837933 GTGGCTTGTGACTGTAGTCTCGG + Intronic
942417651 2:175775777-175775799 GTGGGAAGCGACTGGTTTGTGGG + Intergenic
942717525 2:178910388-178910410 GTGGCTGGAGAGAGTTTTGTTGG + Intronic
943631252 2:190254865-190254887 ATGGCTAGTGGCTGTCTTATTGG - Intronic
944596150 2:201262843-201262865 TTTGCAAGTGACTGTTTTCTAGG + Intronic
945248235 2:207740899-207740921 GTGGCTAATGACTATTGTCTTGG + Intronic
945256652 2:207808848-207808870 GTGACTAGTGACTGCTATGCTGG + Intergenic
945505537 2:210635604-210635626 GTGGCTAGGGGCTGCTATGTTGG + Intronic
946160625 2:217833681-217833703 GTGGCTCGTGACTGCTGTGCTGG - Intronic
946398435 2:219455504-219455526 GTGGCTAGTGGCTGCCTTCTTGG + Intronic
946473411 2:219984085-219984107 GTGGGGAGTGAGTCTTTTGTGGG + Intergenic
946797055 2:223365976-223365998 GTGGCAAGTGACTACTTTATTGG - Intergenic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1168912511 20:1460687-1460709 GTGGCTAGTGGCTTCTCTGTTGG - Intronic
1169513905 20:6295906-6295928 GTGGCTAGTGGCTACCTTGTGGG - Intergenic
1169698113 20:8414810-8414832 GTGGCTAGTGGCTGCCTTATGGG + Intronic
1169921053 20:10734576-10734598 GTGGCTAGTGGCTGATGTCTTGG - Intergenic
1170423473 20:16215311-16215333 GTGGCTGCTGCCTGTTTTGAGGG + Intergenic
1171052752 20:21875403-21875425 GTGGCTGGTGGCTATTCTGTTGG - Intergenic
1172280813 20:33706718-33706740 GTGGCTAGTGGCTGCTGTGACGG - Exonic
1172689479 20:36780313-36780335 GTGGGGAGTTACTGTTTAGTGGG + Exonic
1173050526 20:39555523-39555545 GTGGCTAGTGACTAGTGTATTGG + Intergenic
1173234339 20:41230467-41230489 ATGGCTAGTGGCTGCTGTGTTGG - Intronic
1174035686 20:47666989-47667011 GTGAGGAGTGACTGCTTTGTGGG + Intronic
1174595053 20:51677304-51677326 GTGGTTAGTGACTGTTCTTTTGG - Intronic
1179524328 21:41965893-41965915 GTTTCTAGAGTCTGTTTTGTTGG - Intergenic
1180658844 22:17447915-17447937 GTGGCTCGTGGCTGCTGTGTTGG + Intronic
1181062203 22:20286891-20286913 GTGGCTAGAGAATGTGCTGTTGG + Intergenic
1181628656 22:24138481-24138503 GTGACTAGTGACTGATGTGGGGG - Intronic
1183325817 22:37193125-37193147 ATGGCTAATGGCAGTTTTGTGGG - Intronic
1184784076 22:46663401-46663423 GTGGCTTGTGACAGTTGTGTGGG + Intronic
950829178 3:15858201-15858223 GTGGCTAGTGGCTCTCTTATAGG + Intronic
951129676 3:19026901-19026923 GTGGCTAATGACTACTTTCTTGG + Intergenic
952189283 3:31005406-31005428 ATGGCTAGTGTCTGTTCTGATGG - Intergenic
952521566 3:34163940-34163962 GTGGCTAGTGGCTATTATTTTGG - Intergenic
952818285 3:37464720-37464742 GTGGATACTGACTGCTTTCTAGG - Intronic
954557527 3:51530057-51530079 GTGGCTACTGACTGAGCTGTTGG + Intergenic
954600567 3:51864221-51864243 GTGGCTAGTGGCTACTATGTTGG - Intergenic
955628051 3:60941204-60941226 GTAGCTAGTGGCTGTTGTGTGGG + Intronic
956024807 3:64971793-64971815 GTGTCTAGTGACTGCTGTATAGG - Intergenic
956058434 3:65325305-65325327 GTGGCTAGTGGCTCTCATGTTGG - Intergenic
956330885 3:68106461-68106483 GTGACTGGTGATTGTTGTGTTGG + Intronic
956456086 3:69421610-69421632 GTGGCTAGTGACTAGCTTATGGG - Intronic
956526389 3:70167193-70167215 GTGGCTAGTGACTATCGTATTGG + Intergenic
956682680 3:71796029-71796051 CTGGCCAGGGAGTGTTTTGTTGG - Intergenic
956964799 3:74446479-74446501 GTGGCTAGTGGCTGCTTTACTGG - Intronic
957558138 3:81786589-81786611 GTGGCTGGTGACTGCTTTGCTGG + Intergenic
961111265 3:124285350-124285372 GTGGCTACTGACTGTCCTGTTGG - Intronic
961705060 3:128778250-128778272 GTGGCTAGTAACTGTTACATTGG + Intronic
963847013 3:150169889-150169911 GTGGCTAGTGGCTGCCATGTTGG + Intergenic
964680008 3:159328082-159328104 GTGGCTAATGACTACTATGTTGG - Intronic
967666039 3:192173151-192173173 GGGTGGAGTGACTGTTTTGTTGG + Intronic
968726935 4:2252170-2252192 GTGGCTTGTGTCGGGTTTGTTGG - Intronic
972671730 4:41218832-41218854 GTGGCTAGTGACTGCCATATTGG - Intergenic
973001119 4:44952024-44952046 GTGGCACATGACTGTTTTCTAGG + Intergenic
973066210 4:45796414-45796436 GTGGCTAGTGGCTGTCATATTGG - Intergenic
973750323 4:54011364-54011386 GGAGCTAGTGAATATTTTGTAGG - Intronic
975768346 4:77693186-77693208 ATGCATAGTGTCTGTTTTGTAGG + Intergenic
976091950 4:81467940-81467962 GTGGCTAGTGGCTGCTGTATTGG - Intronic
977595036 4:98869549-98869571 GTGGCTAGTGGTTATTATGTTGG - Intergenic
978525802 4:109663925-109663947 GTGGCAGGTGACAGTTTTGGGGG - Intronic
980182542 4:129419317-129419339 GTGGCTAATGACTGTCTTAGTGG - Intergenic
981952855 4:150431439-150431461 GTGGCTAGTGGCTGCTGTCTTGG - Intronic
982104106 4:151996943-151996965 GTGGCTAGTGACTACTGTTTTGG + Intergenic
982173100 4:152680495-152680517 GTGGCTAGTGGCTGCTGTGTTGG + Intergenic
982271965 4:153599728-153599750 GTGGCTAGTGGCTGTCTTGGAGG - Intronic
984487129 4:180385079-180385101 GTGGCTAGTGACTACTGTATTGG - Intergenic
984791669 4:183620422-183620444 GTGGCTAGTGGCTGCCTTATTGG - Intergenic
985255889 4:188069745-188069767 GTGGCTAGTGGCTAGTGTGTTGG + Intergenic
985315187 4:188651012-188651034 GTGGGTAGTGACTATTTTAAAGG + Intergenic
986878795 5:12144188-12144210 GTGGCAGGTGACTGAATTGTGGG + Intergenic
990081471 5:51920500-51920522 GTTGCTAATGAATGTTTTATAGG - Intergenic
992719504 5:79546496-79546518 GTGGCTAGTGACTATCTTACTGG - Intergenic
992833266 5:80615870-80615892 GTGGCTTGTGAGTGATTTCTGGG - Intergenic
993132457 5:83915927-83915949 ATAGCTAGTGGATGTTTTGTTGG - Intergenic
996311760 5:122113919-122113941 GTGGCTAGTGCTTGTTATATTGG + Intergenic
997431838 5:133846328-133846350 GTGGCTAGTGGCTGCTCTTTTGG + Intergenic
997483861 5:134211802-134211824 GTGGTTAGTGAATCTGTTGTTGG - Intronic
997923388 5:138004507-138004529 GTGGCAAGTGACTATCATGTTGG - Intronic
999426921 5:151496111-151496133 GTGGGAGGTGACTGATTTGTGGG + Intergenic
999839316 5:155407846-155407868 GTGGATAGTGATTGTTATATTGG - Intergenic
1000299304 5:159941238-159941260 GTGGCTAGTGACTGCCATATTGG + Intronic
1001193737 5:169653456-169653478 GTAGCTACTGCCTGTTGTGTGGG + Intronic
1001494367 5:172177515-172177537 GTGGCTAGTGACTGCCATGTTGG - Intronic
1003903097 6:10673421-10673443 GTGGCTAGTGGCTACTGTGTTGG - Intronic
1004521890 6:16369114-16369136 ATGGCTAGTGCATGATTTGTGGG - Intronic
1004708181 6:18144131-18144153 GTGGCTAATGCCTATTTTATTGG - Intronic
1004837971 6:19549450-19549472 GTGGCTAGTGGCTACTGTGTTGG - Intergenic
1005658440 6:27967430-27967452 GTGACTAGTGACTCTTCTGAGGG - Intergenic
1006559695 6:34899961-34899983 GTTGCTACTGACAGTATTGTGGG + Intronic
1008873542 6:56301660-56301682 GTGGTTAGTGGCTATTGTGTTGG - Intronic
1009918095 6:70021826-70021848 GTGGCTAGTGGCTGCTGTATCGG + Intronic
1010210187 6:73356491-73356513 GTGACTAGTGACTTTTGTATTGG - Intergenic
1011272809 6:85596417-85596439 GTGGCTACTGACTATTGTATTGG - Intronic
1013057174 6:106594713-106594735 GTGTCTAGAGACTGCATTGTTGG - Intronic
1013208912 6:107969481-107969503 GGGAATGGTGACTGTTTTGTAGG + Intergenic
1013370262 6:109463448-109463470 GTGGCTAGTGGCTGCTATATTGG - Exonic
1014702001 6:124700624-124700646 CTGGCTAGTAACTGTTTTGGGGG - Intronic
1015284932 6:131475675-131475697 GTGGCTAGTCACTGCTATGTTGG + Intergenic
1015406292 6:132840688-132840710 GTGGCTACTGACTACTTTATTGG - Intergenic
1015931141 6:138360907-138360929 TTGGTCAGGGACTGTTTTGTAGG + Intergenic
1020334875 7:7055428-7055450 GTGGCTAGTGGCAGTTGTATTGG - Intergenic
1020422120 7:8019336-8019358 GTGGCTAGTAGCTGTTGTATTGG + Intronic
1020444265 7:8252504-8252526 GTGGCTAGTGTCTGCTATATTGG - Intronic
1021712823 7:23433303-23433325 GTGGCTAGTGGCTTCTTTATTGG - Intronic
1023488157 7:40709244-40709266 GGGGCTAGTTATTGTTTGGTGGG - Intronic
1024530314 7:50386293-50386315 GTGGCTAGTGGCTGCTGTATTGG - Intronic
1027776401 7:82470816-82470838 GTGGTTAGTGACTGCTACGTTGG + Intergenic
1029639665 7:101812781-101812803 GTGGCTACTTACTGCTTTTTAGG + Intergenic
1029976399 7:104838799-104838821 GTGTCTAGGGACTGCTGTGTTGG + Intronic
1032591182 7:133193818-133193840 GTGCCTGCTGACTGTTCTGTGGG + Intergenic
1035713611 8:1737471-1737493 GTGGGAGGTGACTGTGTTGTGGG - Intergenic
1037726836 8:21489810-21489832 GTGGCTAGTGACTACTGTATTGG + Intergenic
1038230913 8:25698987-25699009 GTGGCTAGTGACTGATGTATTGG + Intergenic
1039668582 8:39566981-39567003 GTGGCTAGTGGCTGGTATATTGG + Intergenic
1039875719 8:41583664-41583686 GTGGTTAGTGGCTGCTCTGTTGG + Intronic
1041713364 8:60912659-60912681 GTAGCCAGAGACTGTATTGTGGG - Intergenic
1042786495 8:72552370-72552392 GTGGCTAGTGACTACTGTATTGG - Intronic
1045116887 8:98992342-98992364 GTGGCAAGTGACTGCCATGTTGG + Intergenic
1046758309 8:117994075-117994097 GTGGCTAGTGGCTGTGTCATTGG - Intronic
1047507658 8:125492619-125492641 GTGGCTAGTGGCTGCTGTGTTGG + Intergenic
1048319776 8:133389336-133389358 TTGGCTAGAGACTGGCTTGTGGG - Intergenic
1048852172 8:138655701-138655723 GTGACCAGTGGCTGTTGTGTTGG + Intronic
1051425701 9:16929611-16929633 GTGGCTAGTGACTACTATATTGG + Intergenic
1051660496 9:19421865-19421887 GTGGCCAGTGACTGTCATATTGG - Intronic
1052034091 9:23660657-23660679 GTGGGTGGTGACTGCTTTGAAGG - Intergenic
1052468354 9:28858942-28858964 GTGACTAGTGAGTGTTTTGCAGG + Intergenic
1052944724 9:34159118-34159140 GTGGTGAGTGACTGGTTGGTTGG - Intergenic
1055441820 9:76344141-76344163 GTGGCTAGTGGCTGCTGTATTGG + Intronic
1056032347 9:82566125-82566147 GTGGCTAGTGACTGTTCTATTGG + Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1057143178 9:92739724-92739746 GTGGCTTGTGGCAGTTTTGGGGG - Intronic
1058886683 9:109326968-109326990 GTGGCTAGTGGCTGCTGTATTGG - Intergenic
1059937348 9:119324272-119324294 GTGACTTGTGACTGGTATGTGGG - Intronic
1060075699 9:120588891-120588913 GTGGCTAGTGGCTATTGTATTGG - Intergenic
1060597916 9:124859069-124859091 GTGGCTAGTGGCTGCTCTGTTGG - Intronic
1061961094 9:133989710-133989732 GTGGCTGGTGTTTGTTTTCTGGG - Intronic
1186882133 X:13877071-13877093 GTGGTGAGGGGCTGTTTTGTGGG - Intronic
1187280609 X:17855977-17855999 GTGGCTAGTGGCTAGTGTGTGGG + Intronic
1187939548 X:24368702-24368724 ATGGCTAGTGGCTATTGTGTGGG + Intergenic
1188620262 X:32212632-32212654 GTGGATTGTCACTGTTTTGGTGG + Intronic
1189281810 X:39824410-39824432 GTGGCTAGTGGCTATTCTATTGG - Intergenic
1189387907 X:40552333-40552355 GTGGCTAGTGGCTGCTCTATTGG + Intergenic
1189468191 X:41293886-41293908 GTGGCTAGTGACTATTGAATTGG - Intergenic
1192534451 X:71915355-71915377 GTGGTTAATGACTGAATTGTTGG - Intergenic
1195521008 X:105828731-105828753 GTCCCTAGTAACTTTTTTGTTGG + Intronic
1195741307 X:108067438-108067460 GTTGCTAGTGATCATTTTGTGGG - Intronic
1198203329 X:134443500-134443522 GTGGCTAGTGGCTGCTATATTGG + Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic