ID: 1090197890

View in Genome Browser
Species Human (GRCh38)
Location 11:124832646-124832668
Sequence CAATTCTAACACCTTCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090197887_1090197890 -2 Left 1090197887 11:124832625-124832647 CCAGCTGTGCATCCTCCAATTCA No data
Right 1090197890 11:124832646-124832668 CAATTCTAACACCTTCCACCTGG No data
1090197884_1090197890 23 Left 1090197884 11:124832600-124832622 CCTCCAATTCTAACTCCAGCAGA No data
Right 1090197890 11:124832646-124832668 CAATTCTAACACCTTCCACCTGG No data
1090197885_1090197890 20 Left 1090197885 11:124832603-124832625 CCAATTCTAACTCCAGCAGATAC No data
Right 1090197890 11:124832646-124832668 CAATTCTAACACCTTCCACCTGG No data
1090197886_1090197890 8 Left 1090197886 11:124832615-124832637 CCAGCAGATACCAGCTGTGCATC No data
Right 1090197890 11:124832646-124832668 CAATTCTAACACCTTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090197890 Original CRISPR CAATTCTAACACCTTCCACC TGG Intergenic
No off target data available for this crispr