ID: 1090199369

View in Genome Browser
Species Human (GRCh38)
Location 11:124843320-124843342
Sequence CCTTCGGAGGACCCCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090199369_1090199376 6 Left 1090199369 11:124843320-124843342 CCCTGGAGGGGGTCCTCCGAAGG No data
Right 1090199376 11:124843349-124843371 CCGCCCTCTCTTTCTAGTAGCGG No data
1090199369_1090199379 25 Left 1090199369 11:124843320-124843342 CCCTGGAGGGGGTCCTCCGAAGG No data
Right 1090199379 11:124843368-124843390 GCGGCTTAGCGCAAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090199369 Original CRISPR CCTTCGGAGGACCCCCTCCA GGG (reversed) Intergenic
No off target data available for this crispr