ID: 1090199896

View in Genome Browser
Species Human (GRCh38)
Location 11:124846449-124846471
Sequence CGGGGTCCCTAAAGGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090199896_1090199902 -5 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199902 11:124846467-124846489 CCCCGAGCCCAGCCTCCCCGGGG No data
1090199896_1090199900 -6 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199900 11:124846466-124846488 ACCCCGAGCCCAGCCTCCCCGGG No data
1090199896_1090199899 -7 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199899 11:124846465-124846487 GACCCCGAGCCCAGCCTCCCCGG No data
1090199896_1090199915 21 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199915 11:124846493-124846515 CCCAGCTGCCAGGGCTGTGGAGG No data
1090199896_1090199919 28 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199919 11:124846500-124846522 GCCAGGGCTGTGGAGGCCCGGGG No data
1090199896_1090199917 26 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199917 11:124846498-124846520 CTGCCAGGGCTGTGGAGGCCCGG No data
1090199896_1090199910 11 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199910 11:124846483-124846505 CCCGGGGTGACCCAGCTGCCAGG No data
1090199896_1090199912 12 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199912 11:124846484-124846506 CCGGGGTGACCCAGCTGCCAGGG No data
1090199896_1090199918 27 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199918 11:124846499-124846521 TGCCAGGGCTGTGGAGGCCCGGG No data
1090199896_1090199921 29 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199921 11:124846501-124846523 CCAGGGCTGTGGAGGCCCGGGGG No data
1090199896_1090199922 30 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199922 11:124846502-124846524 CAGGGCTGTGGAGGCCCGGGGGG No data
1090199896_1090199913 18 Left 1090199896 11:124846449-124846471 CCTAGTTCCCTTTAGGGACCCCG No data
Right 1090199913 11:124846490-124846512 TGACCCAGCTGCCAGGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090199896 Original CRISPR CGGGGTCCCTAAAGGGAACT AGG (reversed) Intergenic
No off target data available for this crispr