ID: 1090200050

View in Genome Browser
Species Human (GRCh38)
Location 11:124847520-124847542
Sequence GGGAACAAAGAGGTGGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090200050_1090200060 18 Left 1090200050 11:124847520-124847542 CCTATTCCCACCTCTTTGTTCCC No data
Right 1090200060 11:124847561-124847583 ACAACTGGCCTTGCTGGCTCTGG No data
1090200050_1090200056 3 Left 1090200050 11:124847520-124847542 CCTATTCCCACCTCTTTGTTCCC No data
Right 1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG No data
1090200050_1090200059 12 Left 1090200050 11:124847520-124847542 CCTATTCCCACCTCTTTGTTCCC No data
Right 1090200059 11:124847555-124847577 ATACAAACAACTGGCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090200050 Original CRISPR GGGAACAAAGAGGTGGGAAT AGG (reversed) Intergenic
No off target data available for this crispr