ID: 1090200051

View in Genome Browser
Species Human (GRCh38)
Location 11:124847526-124847548
Sequence GAAAGAGGGAACAAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090200051_1090200064 28 Left 1090200051 11:124847526-124847548 CCCACCTCTTTGTTCCCTCTTTC No data
Right 1090200064 11:124847577-124847599 GCTCTGGTGCCAAACCAATGGGG No data
1090200051_1090200060 12 Left 1090200051 11:124847526-124847548 CCCACCTCTTTGTTCCCTCTTTC No data
Right 1090200060 11:124847561-124847583 ACAACTGGCCTTGCTGGCTCTGG No data
1090200051_1090200056 -3 Left 1090200051 11:124847526-124847548 CCCACCTCTTTGTTCCCTCTTTC No data
Right 1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG No data
1090200051_1090200065 29 Left 1090200051 11:124847526-124847548 CCCACCTCTTTGTTCCCTCTTTC No data
Right 1090200065 11:124847578-124847600 CTCTGGTGCCAAACCAATGGGGG No data
1090200051_1090200059 6 Left 1090200051 11:124847526-124847548 CCCACCTCTTTGTTCCCTCTTTC No data
Right 1090200059 11:124847555-124847577 ATACAAACAACTGGCCTTGCTGG No data
1090200051_1090200063 27 Left 1090200051 11:124847526-124847548 CCCACCTCTTTGTTCCCTCTTTC No data
Right 1090200063 11:124847576-124847598 GGCTCTGGTGCCAAACCAATGGG No data
1090200051_1090200062 26 Left 1090200051 11:124847526-124847548 CCCACCTCTTTGTTCCCTCTTTC No data
Right 1090200062 11:124847575-124847597 TGGCTCTGGTGCCAAACCAATGG No data
1090200051_1090200066 30 Left 1090200051 11:124847526-124847548 CCCACCTCTTTGTTCCCTCTTTC No data
Right 1090200066 11:124847579-124847601 TCTGGTGCCAAACCAATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090200051 Original CRISPR GAAAGAGGGAACAAAGAGGT GGG (reversed) Intergenic
No off target data available for this crispr