ID: 1090200052

View in Genome Browser
Species Human (GRCh38)
Location 11:124847527-124847549
Sequence TGAAAGAGGGAACAAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090200052_1090200056 -4 Left 1090200052 11:124847527-124847549 CCACCTCTTTGTTCCCTCTTTCA No data
Right 1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG No data
1090200052_1090200065 28 Left 1090200052 11:124847527-124847549 CCACCTCTTTGTTCCCTCTTTCA No data
Right 1090200065 11:124847578-124847600 CTCTGGTGCCAAACCAATGGGGG No data
1090200052_1090200063 26 Left 1090200052 11:124847527-124847549 CCACCTCTTTGTTCCCTCTTTCA No data
Right 1090200063 11:124847576-124847598 GGCTCTGGTGCCAAACCAATGGG No data
1090200052_1090200062 25 Left 1090200052 11:124847527-124847549 CCACCTCTTTGTTCCCTCTTTCA No data
Right 1090200062 11:124847575-124847597 TGGCTCTGGTGCCAAACCAATGG No data
1090200052_1090200060 11 Left 1090200052 11:124847527-124847549 CCACCTCTTTGTTCCCTCTTTCA No data
Right 1090200060 11:124847561-124847583 ACAACTGGCCTTGCTGGCTCTGG No data
1090200052_1090200066 29 Left 1090200052 11:124847527-124847549 CCACCTCTTTGTTCCCTCTTTCA No data
Right 1090200066 11:124847579-124847601 TCTGGTGCCAAACCAATGGGGGG No data
1090200052_1090200059 5 Left 1090200052 11:124847527-124847549 CCACCTCTTTGTTCCCTCTTTCA No data
Right 1090200059 11:124847555-124847577 ATACAAACAACTGGCCTTGCTGG No data
1090200052_1090200064 27 Left 1090200052 11:124847527-124847549 CCACCTCTTTGTTCCCTCTTTCA No data
Right 1090200064 11:124847577-124847599 GCTCTGGTGCCAAACCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090200052 Original CRISPR TGAAAGAGGGAACAAAGAGG TGG (reversed) Intergenic
No off target data available for this crispr