ID: 1090200056

View in Genome Browser
Species Human (GRCh38)
Location 11:124847546-124847568
Sequence TTCACCCTAATACAAACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090200051_1090200056 -3 Left 1090200051 11:124847526-124847548 CCCACCTCTTTGTTCCCTCTTTC No data
Right 1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG No data
1090200050_1090200056 3 Left 1090200050 11:124847520-124847542 CCTATTCCCACCTCTTTGTTCCC No data
Right 1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG No data
1090200052_1090200056 -4 Left 1090200052 11:124847527-124847549 CCACCTCTTTGTTCCCTCTTTCA No data
Right 1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG No data
1090200053_1090200056 -7 Left 1090200053 11:124847530-124847552 CCTCTTTGTTCCCTCTTTCACCC No data
Right 1090200056 11:124847546-124847568 TTCACCCTAATACAAACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090200056 Original CRISPR TTCACCCTAATACAAACAAC TGG Intergenic
No off target data available for this crispr