ID: 1090203694

View in Genome Browser
Species Human (GRCh38)
Location 11:124873427-124873449
Sequence GTTGAAGCAGGTTTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090203694_1090203699 5 Left 1090203694 11:124873427-124873449 CCTTCCTCCAAACCTGCTTCAAC 0: 1
1: 0
2: 2
3: 26
4: 329
Right 1090203699 11:124873455-124873477 GTCGATACCTCCTCAAACTCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
1090203694_1090203700 6 Left 1090203694 11:124873427-124873449 CCTTCCTCCAAACCTGCTTCAAC 0: 1
1: 0
2: 2
3: 26
4: 329
Right 1090203700 11:124873456-124873478 TCGATACCTCCTCAAACTCCGGG 0: 1
1: 0
2: 2
3: 46
4: 928

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090203694 Original CRISPR GTTGAAGCAGGTTTGGAGGA AGG (reversed) Intronic
901184459 1:7363834-7363856 GGTGAAGCAGGTTTAGTAGAGGG - Intronic
901199743 1:7459965-7459987 ATTGAAGCAGATTTCCAGGAAGG - Intronic
901482885 1:9538276-9538298 GGTAGAGCAGGTTTGGGGGAGGG + Intergenic
901946286 1:12706710-12706732 TTGGAAGAAGGTTTAGAGGAAGG + Intergenic
902249811 1:15146898-15146920 CTTGATCCAGGTTTGGAGAATGG - Intergenic
902715143 1:18267547-18267569 GTGGAAAGAGGTTTGGAGAAAGG + Intronic
903932966 1:26874556-26874578 TCTGAAGCAGTTGTGGAGGAGGG - Intergenic
905245654 1:36611606-36611628 CTTGAAGCATGTATGGTGGAGGG + Intergenic
905516289 1:38564453-38564475 GGGGGAGCATGTTTGGAGGAGGG - Intergenic
906188439 1:43879856-43879878 GCTGTAGCAGGTTTGATGGAAGG - Intronic
907283021 1:53363134-53363156 GGAGAAGCAGGTTTGCGGGAGGG - Intergenic
907742992 1:57185109-57185131 GGGGAAGCATGTTTGGAGCAGGG - Intronic
907883665 1:58574288-58574310 GTAGAAACAGGATGGGAGGAGGG + Intergenic
908903251 1:68980171-68980193 GTTGTAGCAGGTTTCCAGGCAGG + Intergenic
909580046 1:77223232-77223254 GTTGAAGCAACTTTGGAACAGGG - Intergenic
913348685 1:117833541-117833563 GTTCATGCAGTTATGGAGGATGG + Intergenic
913615123 1:120551366-120551388 ATGGAAGCAGGTATGGAGGCGGG - Intergenic
914322322 1:146577133-146577155 TTTGAGGTAGGTGTGGAGGAAGG - Intergenic
914575150 1:148959542-148959564 ATGGAAGCAGGTATGGAGGCGGG + Intronic
915457637 1:156051244-156051266 GGTGAAGCAGGCGTGGTGGAGGG + Exonic
916028252 1:160854095-160854117 GATGGAGCAGGTTTGGAGAATGG + Intronic
916734280 1:167593553-167593575 CTTGAGGTAGGATTGGAGGAAGG + Intergenic
916746047 1:167685565-167685587 CTTGAGGAAAGTTTGGAGGAGGG + Intronic
917051816 1:170932835-170932857 GTGGAAGCAGCTTTGGAACAGGG - Intergenic
917609191 1:176669015-176669037 GTTGAGGGAGGATGGGAGGATGG + Intronic
918146385 1:181759635-181759657 AATGAAGCAGGTTGGGGGGAGGG - Intronic
919455124 1:197812235-197812257 CTTGTAGCAGGGTTTGAGGAGGG - Intergenic
920132238 1:203741256-203741278 GCTGAAGCGGGGCTGGAGGAAGG - Exonic
920438939 1:205965721-205965743 GATGGGGCAGATTTGGAGGAGGG - Intergenic
920812469 1:209299773-209299795 GGAGAAGCAGGTTTGGTGGCAGG - Intergenic
920831692 1:209471440-209471462 GTCGAAGCAGGTTTGGAACTAGG - Intergenic
922027150 1:221760833-221760855 GTTGGAACAGGTTTGTAGGGAGG + Intergenic
923661015 1:235957234-235957256 GTGGAAACAGGCTGGGAGGAGGG + Intergenic
1063493029 10:6482565-6482587 GTTCTCGCAGGTCTGGAGGATGG - Intronic
1064068834 10:12207701-12207723 GTGGGAGCAGGGTGGGAGGAAGG + Intronic
1064504690 10:16015784-16015806 GTTGAGGCAGGGGTGGAGGTGGG + Intergenic
1065503008 10:26400279-26400301 GATGAAGCAGGATTGGACAAGGG + Intergenic
1066340611 10:34529289-34529311 TTTGAAAGTGGTTTGGAGGAAGG - Intronic
1067016904 10:42763986-42764008 GTGGAAGCAGCTTTGGAAGTGGG - Intergenic
1067715630 10:48688926-48688948 GTAGAAGCAGATTTGGAAGGTGG + Intronic
1069720390 10:70545800-70545822 GCTGCTGCAGGTTAGGAGGAGGG + Intronic
1070450256 10:76550779-76550801 GTGGAAGCAGTTTTTGAGGAAGG - Intronic
1071801345 10:89065258-89065280 GGAGAAGCAGGTATGGAGAAAGG - Intergenic
1072094130 10:92160414-92160436 GATGAAGCAAATTTGGGGGAGGG - Intronic
1072429479 10:95358098-95358120 GGGGAAGAAGGGTTGGAGGAAGG + Intronic
1073869230 10:107843411-107843433 GTTAAAGTAGGATGGGAGGAGGG - Intergenic
1074177634 10:111025994-111026016 GTTGACGAGAGTTTGGAGGAAGG + Intergenic
1074403091 10:113157862-113157884 CTTGAAGCGGGGTTGGAGGTTGG + Intronic
1077515640 11:3000423-3000445 GGTGAACCAGGTGTGGAGGCAGG + Intergenic
1077779000 11:5304397-5304419 GTTGAAGAAGCTCTGGATGATGG - Intronic
1077871114 11:6262084-6262106 GCAGAAACAGGTTTGGAAGAGGG + Intronic
1079581130 11:22066282-22066304 GTGGAAGCAGCTTTGGAAGTGGG - Intergenic
1080812504 11:35718727-35718749 GTTGCCAGAGGTTTGGAGGAAGG - Intronic
1080847843 11:36041876-36041898 GTTGAGGGGGGTGTGGAGGAGGG + Intronic
1081841380 11:46203960-46203982 GTTGAAGCAGGGTTGGGGTGTGG + Intergenic
1082848173 11:57742724-57742746 GTTGAGTGAGATTTGGAGGAAGG + Intronic
1083700040 11:64470223-64470245 GTTGGTGCAGGTATGGAGAAGGG + Intergenic
1083962027 11:66020060-66020082 GTGGAAGGAGGTTAGGGGGATGG + Intronic
1084562388 11:69912123-69912145 GGTGAAGTGGGTTTGGAGGGAGG + Intergenic
1085070724 11:73542310-73542332 GGAGGAGCAGGTTTGCAGGAAGG - Intronic
1085363917 11:75919825-75919847 GTGGAAGCAGGTCTGAAGAAAGG + Intronic
1085370303 11:75997497-75997519 GTCAAAGCAGTTTTGGAAGATGG + Intronic
1086983925 11:93227770-93227792 GGAGAAGCAGGTTTGGGTGAAGG - Intergenic
1088592446 11:111415279-111415301 GGAGAAGCAGCTTTGGAGGAGGG - Intronic
1089789577 11:120932995-120933017 GGAGAATCATGTTTGGAGGAAGG + Intronic
1090203694 11:124873427-124873449 GTTGAAGCAGGTTTGGAGGAAGG - Intronic
1090922532 11:131218946-131218968 GTTGAATCACGTCTGGAGGATGG + Intergenic
1092233124 12:6788872-6788894 GGAGAAGCAGGTTTGGAGGGTGG + Intronic
1092846665 12:12590401-12590423 GTGGAAGGAAGTTTGGTGGAAGG + Intergenic
1092937091 12:13374283-13374305 CTTGTAGCAGGTTCTGAGGAAGG + Intronic
1093606348 12:21094447-21094469 GGTGGGGCAGGTTGGGAGGACGG - Intronic
1094241398 12:28229831-28229853 CTAGAAGAAGGTTTGGAGGAAGG + Intronic
1095347139 12:41164533-41164555 GTTGGAGCAGGTAAGAAGGATGG - Intergenic
1098039028 12:66335489-66335511 GTGGAGGCAGGTTTTGAAGAGGG + Intronic
1100901492 12:99246209-99246231 GTTGAGGGAGGTTTGGGGGAAGG - Intronic
1102027039 12:109719556-109719578 GCTGGAGCAGGGCTGGAGGAGGG + Intronic
1103965766 12:124638398-124638420 TTTGTCGCAGTTTTGGAGGATGG - Intergenic
1104705408 12:130941928-130941950 CCTGAAGAAGGTTTTGAGGAAGG + Intergenic
1106752919 13:32793556-32793578 GTTGGACCGGGTTTGGAGGTGGG - Intergenic
1108095002 13:46892442-46892464 GTTGAAGCGGCTGTGGTGGATGG + Exonic
1109910473 13:68904772-68904794 GTGGAAGCAGCTTTGGAACAGGG + Intergenic
1110019193 13:70447887-70447909 GAAGAAGCAGGTATTGAGGATGG + Intergenic
1110600312 13:77365174-77365196 GTAGAAGCACATTTGGAGAAAGG + Intergenic
1112006813 13:95260521-95260543 GTTGGAGAGGGTTTGGAGAAAGG + Intronic
1112330605 13:98474537-98474559 GATGGAGCGGGTTTGGAGGGGGG - Intronic
1112496372 13:99908295-99908317 GTGAAGGGAGGTTTGGAGGAGGG + Intergenic
1112610403 13:100949503-100949525 GGTGAAGGAGGGCTGGAGGATGG + Intergenic
1113668838 13:112161381-112161403 ATTCTAGCAGGTTGGGAGGAAGG - Intergenic
1114068336 14:19086105-19086127 GTGGAAGCAGCTTTGGAAGTGGG + Intergenic
1114093929 14:19313920-19313942 GTGGAAGCAGCTTTGGAAGTGGG - Intergenic
1115080414 14:29444157-29444179 ATTGAAGCTGGTTAGGATGAAGG - Intergenic
1115573203 14:34686480-34686502 AGAGAAGCAAGTTTGGAGGAGGG + Intergenic
1116044109 14:39721792-39721814 GTTGGAGCAGTTTAGCAGGAGGG + Intergenic
1116740534 14:48748827-48748849 TTTGAAGCAGATTGTGAGGAAGG - Intergenic
1118836269 14:69480211-69480233 GTGGAAGGAGGCTTGGAGGAGGG + Intergenic
1119200820 14:72751432-72751454 GATGCAGCAGGTCTGGAGCAAGG + Intronic
1120146869 14:80988357-80988379 GGGGAAGTAGGTGTGGAGGAAGG + Intronic
1120159467 14:81130194-81130216 GTGGAAGTAGATTTGAAGGAAGG - Intronic
1121098568 14:91234217-91234239 GTTGAAGCTGGTGAGCAGGAGGG + Exonic
1121175407 14:91887263-91887285 GTTGACGCAGGTTTGCACGCAGG + Exonic
1122009136 14:98731365-98731387 GATACAGCAGGTTTGGAGGCAGG - Intergenic
1122084454 14:99290025-99290047 CTTGAAGCAGGTCCCGAGGATGG + Intergenic
1122463741 14:101916733-101916755 GGTGAAGCAGGTCAGCAGGAGGG + Intronic
1122853953 14:104551337-104551359 GTTGGGGCAAGTTTGGATGAGGG + Intronic
1123014376 14:105366786-105366808 GTGGAGGCAGGGTTGGAGCAGGG + Intronic
1123099330 14:105785598-105785620 CTGGAAGTAGGTCTGGAGGATGG + Intergenic
1124611378 15:31211773-31211795 GTTGAAGCTGGTGAGGAGTATGG + Intergenic
1124875742 15:33591661-33591683 CTTTGAGCAGGTTTGGAGTAAGG - Intronic
1125115452 15:36086232-36086254 GGTGTGGCAGGTGTGGAGGAGGG - Intergenic
1125980360 15:43995570-43995592 GCTGAAGCAGGTTTGGATTCTGG + Intronic
1129110552 15:73334654-73334676 GGGGAGGCAGGTGTGGAGGATGG - Intronic
1129166672 15:73782419-73782441 TTTGGAGCAGGTTTGGATGGTGG - Intergenic
1129432031 15:75506078-75506100 TTTATATCAGGTTTGGAGGATGG + Intronic
1131671619 15:94625899-94625921 GTTGAAGAAGGTCTGAAGGAGGG + Intergenic
1134346078 16:13393115-13393137 TTTGAAGCAGGTTTGGAATGGGG - Intergenic
1134542548 16:15079206-15079228 CTTGAGACTGGTTTGGAGGAGGG - Intronic
1135360125 16:21805285-21805307 CTTGAGACTGGTTTGGAGGAGGG - Intergenic
1136262682 16:29091655-29091677 CTTGAGACTGGTTTGGAGGAGGG + Intergenic
1137619867 16:49869125-49869147 GTTGATGGAGATTTAGAGGAAGG - Intergenic
1139157302 16:64459036-64459058 GCTGAAGAAGGTGTGGAGGAGGG + Intergenic
1140011303 16:71134035-71134057 TTTGAGGTAGGTGTGGAGGAAGG + Intronic
1140579743 16:76215659-76215681 GTGGAATCAGGTTTGGAGGTGGG + Intergenic
1140775132 16:78242569-78242591 GTGGAACCAGGGTTTGAGGAGGG + Intronic
1142135316 16:88449308-88449330 GCTGATGAAGGTTTGGAGCAGGG + Intergenic
1142644412 17:1302703-1302725 TTAAAAGCAGGTTGGGAGGAGGG + Intergenic
1142737176 17:1908364-1908386 GCCGACGCAGGCTTGGAGGACGG - Intergenic
1142969998 17:3604831-3604853 GTGGACGCTGGATTGGAGGAAGG - Intergenic
1143271308 17:5677195-5677217 GTGGAAGCAGCTTTGGAATAGGG + Intergenic
1143523769 17:7461259-7461281 GGTCAAGGAGGTTTGGGGGAGGG - Exonic
1143698292 17:8637191-8637213 GTGGGAGCAGGGTGGGAGGAGGG + Intergenic
1143768107 17:9150823-9150845 GGTCAAGCAGATTTGGGGGATGG + Intronic
1143872751 17:9969453-9969475 GTCGAGGGTGGTTTGGAGGAGGG - Intronic
1144154418 17:12485310-12485332 TTGGCAGCACGTTTGGAGGATGG - Intergenic
1144519322 17:15943999-15944021 GTAGAAGCAGGTGGTGAGGAGGG + Intergenic
1146149483 17:30454591-30454613 GTGGAAGCAGCTTTGGAGCTGGG - Intronic
1146652770 17:34616680-34616702 GTTTGAGCTGCTTTGGAGGAGGG + Intronic
1146744873 17:35319624-35319646 GTGGAAGCAGGTTTGGAACTGGG - Intergenic
1147156744 17:38547896-38547918 GTGGGGGCAGGTTTGGAGGAGGG + Intronic
1147471010 17:40661226-40661248 ATTTAAGCATGTTTGGAGCAAGG - Intronic
1148651483 17:49253238-49253260 GGTGAAGCGGGTTTGAAGGATGG + Intergenic
1149150640 17:53559490-53559512 TATGAAGCAGGTATGGATGAAGG - Intergenic
1149784620 17:59424437-59424459 GTAGAAGGAGGTTTGGATGGAGG + Intergenic
1150927414 17:69547589-69547611 GTTGAGGCAGATTAGGAAGATGG + Intergenic
1151388646 17:73770838-73770860 GATGAAGGAGGGCTGGAGGAGGG + Intergenic
1153617902 18:6951423-6951445 GTTACTGCAGGTGTGGAGGAAGG + Intronic
1153707434 18:7760458-7760480 GTTGAAGCAGGGTTTTAGAAGGG + Intronic
1155332896 18:24735456-24735478 GTTGAAGCAGGTTTGGGTTGAGG + Intergenic
1155484067 18:26321990-26322012 CTTGATGTAGTTTTGGAGGAGGG + Intronic
1155594519 18:27469796-27469818 GTTGAAGCACGACTCGAGGAAGG + Intergenic
1155954667 18:31946999-31947021 CTTGAAGAGGGTTTGGGGGAGGG - Intronic
1157393190 18:47320204-47320226 GTTGAAGCTATTGTGGAGGATGG - Intergenic
1158674215 18:59503556-59503578 GTTGTAGCAGGGATGGAGAAGGG - Intronic
1159503038 18:69298422-69298444 GTGGAAGCAGGGTAGGAGGCAGG + Intergenic
1159598867 18:70409852-70409874 GATGAGGCAGGATTGGAGGCAGG - Intergenic
1159943508 18:74426611-74426633 AATGAATCAGGTTTGAAGGAGGG + Intergenic
1161153940 19:2722676-2722698 GTGGAAGGAGGGCTGGAGGAAGG - Intronic
1164403455 19:27919779-27919801 GATGAAGCTGCTTTGGTGGAAGG + Intergenic
1164771423 19:30812277-30812299 GGTGAAGCAGGACTGGAGCAGGG + Intergenic
1165733073 19:38158796-38158818 GGAGATGCAGGTTTGGGGGAAGG + Intronic
1166344685 19:42157832-42157854 GTGGGAGGAGATTTGGAGGAAGG + Intronic
1167286684 19:48602355-48602377 GAGGAAGCAGGTAAGGAGGACGG + Intronic
1167697547 19:51024211-51024233 GTTGAAGCCGGGGTGGGGGAAGG + Exonic
925015577 2:521967-521989 GTGGAAGGAGGTCTGGAGAAGGG + Intergenic
925304466 2:2838553-2838575 CTTGAAGCAGGTTAGAGGGAAGG + Intergenic
929027988 2:37623735-37623757 GTGGAAGCAGCTTTGGAAGTGGG + Intergenic
930415164 2:51081596-51081618 GAGGTAACAGGTTTGGAGGAAGG - Intergenic
930571495 2:53092026-53092048 GTGGAAGCAGCTTTGGAAGTGGG - Intergenic
932467587 2:71933485-71933507 GGAGGAGCAGGTTTGGGGGAAGG + Intergenic
933157449 2:78991844-78991866 GTTGATGGTGGTTTGGAGGTGGG + Intergenic
933235443 2:79859259-79859281 GTGAAAGCAGGTTATGAGGAGGG + Intronic
935063322 2:99626719-99626741 GTTGATGGAGGCTGGGAGGAGGG - Intronic
936261457 2:110962849-110962871 GTGGAAGCAGGCTTGGACGGGGG + Intronic
941201311 2:162513698-162513720 ATTGAAGTACATTTGGAGGAGGG - Intronic
942555152 2:177165230-177165252 GCTGAAGCTGGTTAGGAGGAAGG - Intergenic
942903835 2:181157061-181157083 GTTGAAGGAGGCCTGGTGGAAGG - Intergenic
943356872 2:186867249-186867271 GTTCCAGCAGGTTTGGTGTATGG + Intergenic
943576779 2:189639473-189639495 GATGCAGCAGGTCTGGAGCAGGG - Intergenic
944763611 2:202841783-202841805 GTTGATGCAGGAGTGGAGGCAGG + Intronic
948863116 2:240762539-240762561 GTGGAAGCAGCATTGGGGGAGGG - Intronic
1168756387 20:321344-321366 GTTGTAGTTGGATTGGAGGAGGG - Intergenic
1168980490 20:1999337-1999359 TCTGAAGCACGTTTGGAGGCTGG + Intergenic
1169685732 20:8268968-8268990 ATTGAGGCAGTCTTGGAGGAAGG + Intronic
1169693165 20:8356487-8356509 GCTGAAGAAGGTAAGGAGGAAGG + Intronic
1170231514 20:14051937-14051959 GTTGAAGAAGTGGTGGAGGATGG + Intronic
1170807390 20:19644386-19644408 GATGCAGCAGGTCTGGAGGGAGG + Intronic
1171197231 20:23209231-23209253 ATAGAAGCAGGTTTGGAAGTGGG + Intergenic
1171399196 20:24860803-24860825 GTGGAAGCAGGTTTGCAGGGAGG + Intergenic
1174136894 20:48385999-48386021 GTTGAATCAGGCTAGGAGGCAGG - Intergenic
1174548946 20:51347385-51347407 GTTGAAGCAGGTGTTGATGCAGG + Intergenic
1175307702 20:57988573-57988595 GTAGAAGGAGATTTGGAAGAGGG - Intergenic
1176338585 21:5621999-5622021 GCTGAAGCAGGATTGTACGAGGG + Intergenic
1176339993 21:5685072-5685094 GCTGAAGCAGGATTGTACGAGGG + Intergenic
1176472247 21:7117225-7117247 GCTGAAGCAGGATTGTACGAGGG + Intergenic
1176495808 21:7499003-7499025 GCTGAAGCAGGATTGTACGAGGG + Intergenic
1176504834 21:7639384-7639406 GCTGAAGCAGGATTGTACGAGGG - Intergenic
1178237219 21:30856899-30856921 ATTAAAGCAGGGTGGGAGGAGGG + Intergenic
1180178669 21:46106672-46106694 GTGGAAGCAGGCTGGGATGAGGG - Intronic
1180486807 22:15808667-15808689 GTGGAAGCAGCTTTGGAAGTGGG + Intergenic
1181336334 22:22133233-22133255 GTTGAAGCAGGGTTGGGGGTGGG + Intergenic
1181587769 22:23863160-23863182 GTGGAAGGAGGCTTAGAGGAAGG - Intronic
1181879076 22:25963216-25963238 TTTGACTCAGGTTGGGAGGAGGG + Intronic
1182659505 22:31915374-31915396 GTTCTAGCAGGTGAGGAGGATGG + Intergenic
1183387494 22:37523475-37523497 GTTGAAGGAGGATTGGAAGGGGG + Intergenic
1184254422 22:43278946-43278968 GCTGAGACAGGTTTGGGGGAAGG + Intronic
1184602240 22:45550528-45550550 GTTGAAGCAGGTCTCGTTGATGG - Exonic
949585067 3:5429138-5429160 AATCAAGCAGGTTAGGAGGAAGG + Intergenic
951241306 3:20288833-20288855 GTGGAAGCAGATTTGGAGCCCGG - Intergenic
952887477 3:38020489-38020511 GTTGGAGCATGGGTGGAGGAGGG - Intronic
953667569 3:44936877-44936899 GTTCAAGCAGGTTTTGGGGGGGG - Intronic
955727997 3:61953145-61953167 GGTGAAGCAGGTTGGGAGGAGGG - Intronic
956203696 3:66733996-66734018 GTGGTAGCAGGTTGGTAGGAAGG - Intergenic
956252563 3:67250021-67250043 GATAAAGCAGGTTGGGAAGATGG - Intergenic
956401899 3:68888484-68888506 GTGGAAGCAGCTTTGGAGTTGGG - Intronic
957976551 3:87453109-87453131 GTTGACGAAGGTGTGGAGGAAGG - Intergenic
958012722 3:87900803-87900825 AGAGAAGCAGGTTTGGAAGAAGG + Intergenic
959289066 3:104449615-104449637 GCTGGAGCAGGTTTGGAGGCTGG - Intergenic
960973112 3:123153247-123153269 GTGAAACCAGGTTTTGAGGAAGG + Intronic
961125011 3:124409504-124409526 GCTTAAGCAGATTGGGAGGAAGG + Intronic
962712975 3:138102919-138102941 GTGGAAGCAGGAGTGGAGGCAGG + Intronic
963108255 3:141664677-141664699 GTGGAAGGAGGCTTGGGGGAAGG - Intergenic
963416503 3:145001797-145001819 GTAGAAGCAGCTTTGGAATAGGG - Intergenic
963703808 3:148660454-148660476 CTTGAGGCAGGCTTGGAGGCTGG + Intergenic
963732574 3:148987323-148987345 GGTGAAGCAGGCGTGGTGGAGGG + Intergenic
965274427 3:166662993-166663015 GTTGAAACAGGCATTGAGGAGGG - Intergenic
965814189 3:172619789-172619811 GTTGTTGCAGGTTTGGAATAGGG - Intergenic
966209620 3:177439727-177439749 GGTGGAGCAGGGTTGGAGCAGGG - Intergenic
966302590 3:178495949-178495971 GTGGAAGCAGCTTTGGAACAGGG + Intronic
967610908 3:191504894-191504916 GTGGAGGCAGGCTTGCAGGACGG + Intergenic
968734043 4:2286038-2286060 CATGGAGCAGGTTTGGAGGTGGG - Intronic
969849742 4:9946983-9947005 CCTAAAGCAGGCTTGGAGGAAGG - Intronic
969996974 4:11323359-11323381 GTGGAAGCAGCTTTGGAGCTGGG + Intergenic
970376866 4:15467570-15467592 GATGAGGCAGATGTGGAGGACGG + Intergenic
970960140 4:21861964-21861986 GTTTAAGGAGGCTTGGAGGAGGG - Intronic
971126096 4:23756690-23756712 GTAGAAGATGGATTGGAGGATGG - Intronic
971311590 4:25530011-25530033 TTGCATGCAGGTTTGGAGGAAGG + Intergenic
973650049 4:52989957-52989979 GTTGAAGGAGGCATGAAGGATGG - Intronic
973896904 4:55422543-55422565 GTTGAATCAGGGTGGGTGGATGG - Intronic
976527203 4:86107544-86107566 GATGAAGAAGAGTTGGAGGAAGG + Intronic
977165516 4:93690293-93690315 TCTGAGGCAGGTGTGGAGGAAGG + Intronic
978574366 4:110173832-110173854 GATGGAGGAGGTTGGGAGGAGGG + Intronic
978833696 4:113120751-113120773 GAGGATGCAGGTTGGGAGGAGGG - Intronic
979180480 4:117720760-117720782 GTTGAAGCAGCTTTGGAACTGGG + Intergenic
979552922 4:122011245-122011267 CATGAATCAGGATTGGAGGATGG + Intergenic
981796777 4:148604690-148604712 GTAGAAGCAGATTTGGAGTTGGG + Intergenic
986102830 5:4629802-4629824 GGTGAAGAACATTTGGAGGAAGG + Intergenic
986144069 5:5060475-5060497 GTTCACCCAGGTTTGGGGGAGGG + Intergenic
986195136 5:5531469-5531491 GTTGACGCAGGTTTTGAGAGAGG - Intergenic
989070896 5:37510252-37510274 GTTGAGGGAGGAATGGAGGAGGG - Intronic
989451559 5:41592449-41592471 TAAGAAGCAGGTTTGGAGGTAGG + Intergenic
989845098 5:46131319-46131341 GTGGCAGCAAGTTTGGGGGAGGG + Intergenic
991396263 5:66208225-66208247 GGTGAGGCAGGTGGGGAGGAGGG + Intergenic
991509180 5:67357994-67358016 GAAGAAGCAGGTTTGGGGAACGG - Intergenic
993115168 5:83711392-83711414 ATTGGAGCAAGTGTGGAGGACGG + Intronic
993457321 5:88141500-88141522 GCTGACGCGGGTTTGGAGAACGG + Intergenic
994079003 5:95685337-95685359 TTTGAAGTAGGTTTGAGGGAAGG - Intronic
994320967 5:98393531-98393553 GTGGAAGCAGGAGTGGAGGCAGG + Intergenic
995759912 5:115552087-115552109 GTTGAAGCAGCTCTGGAGTTTGG - Intergenic
995804817 5:116039253-116039275 GTTGAAGGATGATAGGAGGAGGG - Intronic
996188957 5:120514917-120514939 GTGGAAGCAGATTTGGAAGTGGG - Intronic
997825904 5:137106690-137106712 GTTGGGGCAGGATTGGAGGCAGG - Intronic
998278476 5:140781986-140782008 GTGGAAGCAGCTTTGGAGCTGGG + Intergenic
998771069 5:145546385-145546407 TTTGAACAAGATTTGGAGGAAGG + Intronic
999067775 5:148709859-148709881 GTTGAAGTAGATACGGAGGATGG + Intergenic
999711241 5:154320478-154320500 ATTGAAGCAGGGTTGGGGGCGGG - Intronic
1001060722 5:168486534-168486556 GCTGCAGCAGGTTTGGACGCAGG + Exonic
1003525542 6:6893790-6893812 GTTGAATCACTTTTGAAGGAAGG - Intergenic
1005670935 6:28105408-28105430 TCTGGAGCAGGTTTGGAGAAAGG - Intergenic
1006389417 6:33749712-33749734 GTAGAAGCAGGTTAGGGGGAGGG + Intergenic
1006483386 6:34317174-34317196 GGCGAAGCAGGTTTGGGGGAAGG + Intronic
1007777741 6:44233200-44233222 GTGGAGACAGGTTTGCAGGAAGG + Intronic
1010087667 6:71939402-71939424 GTGGAAGCAGCTTTGGAACAGGG - Intronic
1010890117 6:81297430-81297452 ATTGAAGCAGGTTTAGTGCAAGG - Intergenic
1011512770 6:88119436-88119458 GGTGAAAGAGGTTTGGAAGAGGG - Intergenic
1011716407 6:90109659-90109681 AAAGAAGCAGGTTTGGAGGGAGG - Intronic
1012298068 6:97549381-97549403 GTTGAAGCAGGTGTGGGGGGTGG + Intergenic
1016291455 6:142532730-142532752 GTGGAAGCATGTGTGGAGGTGGG + Intergenic
1016526066 6:145002823-145002845 GTAGAATTAGGTTTGGAGGCAGG + Intergenic
1016816982 6:148311884-148311906 GTTGAAGCAGGTTTGAAAATTGG - Intronic
1017196598 6:151707061-151707083 GTTGAAGGAGCATTGGAGGCAGG + Intronic
1017391877 6:153948844-153948866 GTGGAGGAAGGTTGGGAGGAAGG + Intergenic
1017888336 6:158619517-158619539 GAGGAAGGAGTTTTGGAGGAAGG + Intronic
1017900851 6:158717516-158717538 GATGAAGAAAGTTTGAAGGAAGG - Intronic
1018258334 6:161944298-161944320 CTTGACAAAGGTTTGGAGGAGGG + Intronic
1019862713 7:3675129-3675151 GGTGGAGCAGGTTTGGGGCATGG - Intronic
1020338013 7:7078726-7078748 GTTCAAGCAGATATGAAGGATGG + Intergenic
1023555008 7:41412561-41412583 GGTGGTGGAGGTTTGGAGGAGGG - Intergenic
1023785270 7:43701263-43701285 GTTGATGGAGGATTTGAGGATGG - Intronic
1023847955 7:44133576-44133598 GTTGGGGCAGGGATGGAGGAGGG + Intergenic
1024599664 7:50969631-50969653 GCAGAAGAAGGTTTGGAGGTGGG - Intergenic
1024994981 7:55267170-55267192 TTCGCAGCAGTTTTGGAGGACGG + Intergenic
1026196777 7:68180134-68180156 GGTGATGCTGGTGTGGAGGATGG + Intergenic
1026577003 7:71580766-71580788 GTTGGAGGAGGTTTGGGAGAAGG + Intronic
1027860678 7:83575223-83575245 GTTGAAGGAGGGTAGCAGGATGG + Intronic
1030001123 7:105064064-105064086 GCTGAACCAGGGTTGGGGGAGGG - Intronic
1030447305 7:109663105-109663127 GCAGAAGCAGCTTGGGAGGAAGG - Intergenic
1030608932 7:111668127-111668149 GTGGAAGCAGATTTTGAAGATGG + Intergenic
1031114767 7:117655643-117655665 GTGGAAGCAGCTTTGGAACAAGG - Intronic
1032198834 7:129805098-129805120 GATGAAGCAGGCCTGGAGGATGG + Intergenic
1032233739 7:130101466-130101488 GATGGAGCAGTTTTGGGGGAAGG + Intronic
1032906307 7:136371393-136371415 GAGGAAGGAGGTTGGGAGGAGGG - Intergenic
1033729370 7:144159903-144159925 GTTCCAGGAGTTTTGGAGGAGGG - Intergenic
1034710495 7:153186888-153186910 GTGGAAGCAGCTTTGGAAGTGGG - Intergenic
1035380252 7:158434214-158434236 GCTGAAGCAGGTCTGAAGAACGG - Intronic
1035420985 7:158729162-158729184 GTTGGAGCAAGTGTGGAGGTGGG + Intergenic
1035864829 8:3070774-3070796 GTTGAAGCAGCTTTGGAACTGGG - Intronic
1038363248 8:26904446-26904468 GTGGGAGCAGGTTTGGAGGGAGG + Intergenic
1039880652 8:41623469-41623491 GGTGCAGCAGGCTTGGAGGGGGG - Exonic
1041457504 8:58076424-58076446 GGTGGAGCATCTTTGGAGGATGG + Intronic
1043186670 8:77160291-77160313 GTTGGGGAAGGATTGGAGGAAGG + Intergenic
1045425266 8:102059924-102059946 GATGCAGCAGGTCTGGAGTACGG + Intronic
1045495268 8:102702755-102702777 GTTGCTGCAGCTTTGGAAGAGGG + Intergenic
1046322153 8:112593874-112593896 GGTGATACAGGTTTGAAGGAAGG + Intronic
1046732226 8:117738049-117738071 GTTGAAGCAGTTTTGGAGGGAGG - Intergenic
1048031933 8:130641231-130641253 GTTGAAGTGGGTTTGGAGACAGG - Intergenic
1049832467 8:144710790-144710812 GATGAGGAAGGTTTGGATGAAGG + Intergenic
1050577093 9:7008385-7008407 GTTGAGGCAGACTTGGAGGCTGG - Intronic
1050974248 9:11916469-11916491 GTGAAAGCAGGTTTGGAAGTGGG - Intergenic
1051115634 9:13690953-13690975 GTTGTCACAGGTTAGGAGGAAGG - Intergenic
1051920605 9:22259466-22259488 GTGGAAGCAGGTTTGGAACTGGG + Intergenic
1052508834 9:29388702-29388724 GTTGCAGAAGATGTGGAGGAGGG - Intergenic
1052755421 9:32536036-32536058 GTAGAAGAAGGTTTTGAGTAGGG - Intergenic
1053447893 9:38166992-38167014 GTTGAAGAAGGGAAGGAGGAAGG - Intergenic
1056029987 9:82543463-82543485 TTTGAAGTAGGTGTGGAAGAGGG - Intergenic
1057879884 9:98785408-98785430 GTGTCTGCAGGTTTGGAGGAGGG - Intronic
1058136671 9:101315492-101315514 GTTGAAGCAGGATTTGTGTATGG - Intronic
1058164859 9:101607680-101607702 GTTGAAGTAGGCTTCAAGGATGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061594376 9:131619441-131619463 CTGGAAGCAGGTTGGGTGGAAGG + Intronic
1062158127 9:135065460-135065482 GGGGAAGCAGGATGGGAGGATGG - Intergenic
1062473521 9:136716754-136716776 GGAGAACCAGGTTTGGAGAACGG - Intronic
1203423074 Un_GL000195v1:12921-12943 GCTGAAGCAGGATTGTACGAGGG - Intergenic
1203547134 Un_KI270743v1:136803-136825 GTTGAAGCAGCTTTGGAACCAGG - Intergenic
1186398365 X:9233553-9233575 GTTGAAGCAGATTTTAGGGAAGG + Intergenic
1186610521 X:11134293-11134315 GTAGAATCATGTTTGTAGGAAGG + Intergenic
1189908383 X:45784883-45784905 GTAGAAGCAGTATTTGAGGAAGG - Intergenic
1190113991 X:47613840-47613862 GTTGACACTGTTTTGGAGGATGG - Intronic
1190447063 X:50536633-50536655 GAAGGAGCAGATTTGGAGGAAGG + Intergenic
1190626657 X:52343814-52343836 GTTGAGGCAGGGTAGGAGCAGGG + Intergenic
1190701354 X:52992015-52992037 GTTGAGGCAGGGTAGGAGCAGGG - Intronic
1190793893 X:53723800-53723822 GTAGAAGCAGCTTTGGAGTCAGG + Intergenic
1191220604 X:57984662-57984684 GTGGAAGCAGGAGTGGAGGCAGG - Intergenic
1192409975 X:70925428-70925450 GTTGAATCAGGGTTTGAGGAGGG - Intergenic
1192839323 X:74837214-74837236 GTTGAAAGAGGTATTGAGGAGGG - Intronic
1193197876 X:78655742-78655764 GTTGAAGAGGGTTTAGAGGAGGG - Intergenic
1193199886 X:78676433-78676455 GAGGATGGAGGTTTGGAGGAGGG - Intergenic
1193200058 X:78678605-78678627 GAGGATGGAGGTTTGGAGGAGGG + Intergenic
1193601530 X:83512499-83512521 GGAGAGGCAGGTTTGGAGAAAGG - Intergenic
1194306936 X:92259183-92259205 GTTGAAGCAGCTTTGGAATTTGG - Intronic
1194813181 X:98411480-98411502 GGTGAAATAGGTTTGGAGAAGGG - Intergenic
1195295482 X:103472405-103472427 GTGGAAGCAGCTTTGGAGCTAGG + Intergenic
1195889878 X:109681517-109681539 TTTGAAGCAAGGTTGAAGGATGG - Intronic
1196668024 X:118336563-118336585 GAGGGAGAAGGTTTGGAGGAGGG + Intergenic
1198080306 X:133233560-133233582 ATTCAAGCAGGGTTGGTGGATGG - Intergenic
1199054789 X:143280907-143280929 TTTCAAGCAGGCTGGGAGGAAGG - Intergenic
1199450784 X:147976904-147976926 TTTGGAGCAAGTTTGGAGCAAGG + Intergenic
1199993729 X:153005619-153005641 GTGGAAGCAGCTTTGGAGCTGGG - Intergenic
1201539634 Y:15091745-15091767 GTTGAAGAAGTTTTGCAGGCCGG - Intergenic
1202019762 Y:20452155-20452177 GTGGAAGCAGCTTTGGAGCTGGG + Intergenic