ID: 1090205183

View in Genome Browser
Species Human (GRCh38)
Location 11:124879926-124879948
Sequence CATCTGGGTGGAGCACCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090205183_1090205192 -3 Left 1090205183 11:124879926-124879948 CCAGCGGGTGCTCCACCCAGATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1090205192 11:124879946-124879968 ATGGTAAGCAGGGCCAGGGCAGG 0: 1
1: 0
2: 3
3: 48
4: 495
1090205183_1090205199 28 Left 1090205183 11:124879926-124879948 CCAGCGGGTGCTCCACCCAGATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1090205199 11:124879977-124879999 CTGCTGCCACAGGAGACTGTGGG 0: 1
1: 0
2: 0
3: 34
4: 262
1090205183_1090205195 5 Left 1090205183 11:124879926-124879948 CCAGCGGGTGCTCCACCCAGATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1090205195 11:124879954-124879976 CAGGGCCAGGGCAGGCAGGAGGG 0: 1
1: 2
2: 17
3: 167
4: 1232
1090205183_1090205193 1 Left 1090205183 11:124879926-124879948 CCAGCGGGTGCTCCACCCAGATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1090205193 11:124879950-124879972 TAAGCAGGGCCAGGGCAGGCAGG 0: 1
1: 0
2: 7
3: 78
4: 585
1090205183_1090205189 -8 Left 1090205183 11:124879926-124879948 CCAGCGGGTGCTCCACCCAGATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1090205189 11:124879941-124879963 CCCAGATGGTAAGCAGGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 263
1090205183_1090205198 27 Left 1090205183 11:124879926-124879948 CCAGCGGGTGCTCCACCCAGATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1090205198 11:124879976-124879998 GCTGCTGCCACAGGAGACTGTGG 0: 1
1: 0
2: 3
3: 57
4: 428
1090205183_1090205197 18 Left 1090205183 11:124879926-124879948 CCAGCGGGTGCTCCACCCAGATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1090205197 11:124879967-124879989 GGCAGGAGGGCTGCTGCCACAGG 0: 1
1: 0
2: 3
3: 37
4: 375
1090205183_1090205191 -7 Left 1090205183 11:124879926-124879948 CCAGCGGGTGCTCCACCCAGATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1090205191 11:124879942-124879964 CCAGATGGTAAGCAGGGCCAGGG 0: 1
1: 0
2: 2
3: 23
4: 231
1090205183_1090205194 4 Left 1090205183 11:124879926-124879948 CCAGCGGGTGCTCCACCCAGATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1090205194 11:124879953-124879975 GCAGGGCCAGGGCAGGCAGGAGG 0: 1
1: 3
2: 19
3: 203
4: 1555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090205183 Original CRISPR CATCTGGGTGGAGCACCCGC TGG (reversed) Exonic
901020683 1:6253834-6253856 CATCGTGGTGGAGGACGCGCAGG - Exonic
902075499 1:13781422-13781444 TATCTGGGTGGAGATCTCGCTGG - Exonic
903209904 1:21812112-21812134 CTTCTGGGAGGAGGACCCACAGG - Intergenic
903817549 1:26075787-26075809 CCTCTGCTTGGAGCACCCTCAGG + Intergenic
905528835 1:38660552-38660574 CATCTGTCTGGAGCAGCTGCAGG + Intergenic
906692228 1:47800077-47800099 CAACTGGCTGGAGCAGCCCCTGG - Intronic
917200954 1:172514822-172514844 CATCTGGGTGGTGCACTTGATGG - Intergenic
922876405 1:228943082-228943104 CTTCAGGGTGGAGCCCTCGCTGG - Intergenic
924855153 1:247868488-247868510 CATCTGGCTGGAGTATCTGCTGG - Intronic
1072674166 10:97453221-97453243 CATCTGTGTGGAACAGCAGCTGG - Intronic
1074693840 10:116030159-116030181 ACCCTGGGTGGAGGACCCGCTGG - Intergenic
1076236718 10:128869161-128869183 CATCTGGATGGTGCTCCGGCGGG + Intergenic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1095960253 12:47829744-47829766 CATCTGGTTGGAGCTCTGGCTGG + Intronic
1103538117 12:121647510-121647532 AATGTGGGTGGAGCATCAGCAGG + Intergenic
1103609932 12:122117105-122117127 CATGTGGGCGGAGCACCTGCAGG + Intronic
1103839050 12:123847973-123847995 TATCTAGGTGGGGCCCCCGCCGG + Exonic
1106162288 13:27212263-27212285 CATCTGGGACGAGCTCCCTCTGG + Intergenic
1107751553 13:43572681-43572703 CATCTCTGGAGAGCACCCGCTGG - Intronic
1110971726 13:81771321-81771343 CCTCTGGGTGGGGCAACTGCTGG - Intergenic
1112435636 13:99389746-99389768 CTTCTGCGTGGAGCTCACGCAGG - Intergenic
1113418927 13:110154979-110155001 CACCTGAGTGGAGCAGCCACAGG + Intronic
1117157175 14:52951851-52951873 CATCTGGCTGGAGCGTCCGAAGG - Intronic
1124523736 15:30428112-30428134 CCTATGGGGGGAACACCCGCAGG - Intergenic
1124534931 15:30538103-30538125 CCTATGGGGGGAACACCCGCAGG + Intergenic
1124763718 15:32469504-32469526 CCTATGGGGGGAACACCCGCAGG - Intergenic
1124774909 15:32579547-32579569 CCTATGGGGGGAACACCCGCAGG + Intergenic
1136454866 16:30374706-30374728 TATCTGGGGTGGGCACCCGCAGG + Intronic
1137052015 16:35722439-35722461 CATCTCTGTGGAGCACAGGCTGG - Intergenic
1139467059 16:67159723-67159745 CAGCTGGCTGGAGCAGCCGCCGG + Intronic
1141995045 16:87631265-87631287 CATTTGGGTGGAGCACATCCTGG + Intronic
1143054721 17:4154347-4154369 CATGTGCTTGGAGCACACGCTGG - Intronic
1145791455 17:27630234-27630256 CATCTAGGTGGAGCACAGGAAGG + Exonic
1147591997 17:41689502-41689524 CAGCTGGGTGGGGCACCGCCTGG + Intronic
1149971963 17:61227672-61227694 CATCAGGTTGGAGCACACTCGGG + Intronic
1151369305 17:73637861-73637883 CATCTGGGTTGGGCAGCCCCTGG - Intronic
1153372303 18:4333229-4333251 CATCTGGGATGAGCAGCCCCTGG - Intronic
1160319962 18:77881076-77881098 TACCTGAGTGGAGCACCGGCAGG + Intergenic
1161459666 19:4389275-4389297 CATCTGGGTGGGGGACCCCGAGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162547562 19:11339635-11339657 CTTCTGGGCGGAGCCCGCGCGGG - Exonic
1163826102 19:19525807-19525829 CAGCTGTGTGCAGCCCCCGCAGG + Intronic
1164456502 19:28411832-28411854 CATCTGGGTTGAGGACACACAGG - Intergenic
1165888938 19:39099136-39099158 CATGTGGGTGAGGCATCCGCAGG + Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1167249560 19:48392899-48392921 CATCTGGGTGTGGGACCCCCGGG + Intergenic
1168282229 19:55311937-55311959 CTTCGGGGTGGGGCACCAGCAGG - Exonic
1168326550 19:55541436-55541458 CATCTGCGTGGACCAGCCCCCGG + Exonic
926223982 2:10954616-10954638 CATGTGGGTGGGGCCCCAGCAGG - Intergenic
926954761 2:18282296-18282318 CTTCTGAGTGGAGCACCTGAGGG + Intronic
928942219 2:36737842-36737864 AATCTGTGTGGAGAACCCACTGG - Intronic
932036765 2:68253110-68253132 CACCCCGGTGCAGCACCCGCAGG + Exonic
934176531 2:89583425-89583447 CAGCTGGGTGGGGCAGCCACAGG - Intergenic
934286841 2:91657786-91657808 CAGCTGGGTGGGGCAGCCACAGG - Intergenic
934767657 2:96889041-96889063 GATCTGGGTGGTGCCCCCGCAGG + Intronic
1170961252 20:21027803-21027825 CAGTTGGGTGGAGCAACCCCAGG - Intergenic
1171448279 20:25219698-25219720 CATTTGGCTGGAGCACACGTAGG - Intronic
1172602744 20:36195178-36195200 CAGCTGGGTGGGCCACCAGCAGG - Intronic
1175334573 20:58186877-58186899 CGTCTGGATGGAGCAGCTGCAGG - Intergenic
1175975746 20:62709588-62709610 CATCTGGGTGCACCACCCCTGGG + Exonic
1178904324 21:36624001-36624023 CATCTGGCTCAAGCACCCACAGG + Intergenic
1179558055 21:42193254-42193276 CAGCAGGGTGAAGCCCCCGCGGG + Intergenic
1179787876 21:43740119-43740141 CATCTGGGGGGTGCACCTGGGGG - Intronic
1180620466 22:17158715-17158737 CTTGGGGGCGGAGCACCCGCAGG + Intronic
1182760833 22:32721190-32721212 CTCCTGGGTGGAGCTCCCGGTGG + Intronic
1184726263 22:46348455-46348477 TCTCTGGGTAGAGCACCTGCAGG + Intronic
1184960167 22:47922918-47922940 CATCTGCATGGAGCACCCCAGGG - Intergenic
1185123933 22:48993449-48993471 CATGTGGGTGGAACACGCACAGG + Intergenic
950887415 3:16373896-16373918 CATCTGGATGGAGCAGCCTGGGG - Intronic
951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG + Intronic
962382000 3:134905529-134905551 CATCTGTAGGGACCACCCGCTGG + Intronic
966841296 3:184090382-184090404 AATCTGGGTGAAGCACACACAGG - Intergenic
968661243 4:1799676-1799698 CATCTGGGAGGGGCACCTGGGGG + Intronic
968760995 4:2442759-2442781 CAGCTGGGAGGAGCAGCCCCCGG - Intronic
981237851 4:142439009-142439031 CATCTGAGTGGTGCACCCCATGG - Intronic
983077612 4:163344302-163344324 CACCCGGGTGGAGCAGGCGCGGG + Exonic
985508524 5:298834-298856 CAGCTGGGGGGAGCAGCTGCGGG - Intronic
985579628 5:689889-689911 CATCTGGGTGGAGGATCATCTGG + Intronic
985594474 5:781948-781970 CATCTGGGTGGAGGATCATCTGG + Intergenic
989565619 5:42898433-42898455 CAGCTGGGTGGATCACTTGCTGG - Intergenic
989567591 5:42916447-42916469 CAGCTGGGTGGATCACTTGCTGG + Intergenic
990332602 5:54742512-54742534 CGTGTGGGTGGAGCACCCCCAGG - Intergenic
993296181 5:86144125-86144147 CATCTGGCTGGAGCCCAGGCAGG + Intergenic
997570133 5:134921043-134921065 CAGGTGGGTGGAGCAGCCCCAGG + Intronic
1001299231 5:170522091-170522113 CAGCTGGGTGGAGTCCCAGCTGG + Intronic
1010747309 6:79578390-79578412 CATATGGGTGGAGGCCCCTCTGG + Intergenic
1018652550 6:166004209-166004231 CTTCTGGGAAGAGCACCCCCAGG - Intergenic
1019122050 6:169811562-169811584 CAGCTGGGTAGAGGACCCACAGG - Intergenic
1023863829 7:44229526-44229548 CAGGTGGGTGGTGCGCCCGCAGG + Intronic
1024296889 7:47851327-47851349 CATCTTGGAGGAGCTCCCACTGG + Intronic
1026955905 7:74376366-74376388 CATCAAGATGGAGCACCAGCTGG + Exonic
1034940498 7:155227350-155227372 CAGCTGGGTGGAGAATCAGCAGG + Intergenic
1039374156 8:37016419-37016441 CACCTGGATGGAGCAGCCACAGG - Intergenic
1049713845 8:144080235-144080257 CATCTGCCTGTAGCACCTGCAGG - Exonic
1052027318 9:23588079-23588101 CCTCTGCATGGAGCACCCTCTGG + Intergenic
1052324578 9:27203694-27203716 CATGTGGGTGGAGCTGCAGCAGG + Intronic
1057155667 9:92837000-92837022 CAGCTGGATGGAGCACACACAGG + Intergenic
1057515181 9:95714481-95714503 GATCTGGGTGGAGCATCGTCTGG + Intergenic
1062439208 9:136562121-136562143 CCTCTGGGTGGAGCTCTCTCGGG - Intergenic
1062622238 9:137428342-137428364 CTTCTGGGTGGAGCCACCCCTGG - Intronic
1062724112 9:138061625-138061647 CATCAGCTTGGAGCACACGCAGG - Intronic
1192034311 X:67546304-67546326 CATCAAGCTGGAGAACCCGCTGG + Exonic
1198278907 X:135123325-135123347 CATCTGCGTGGAGCATCAGGAGG + Intergenic
1201010580 Y:9546265-9546287 CCTTTGGGTGCAGCGCCCGCAGG + Intergenic