ID: 1090205199

View in Genome Browser
Species Human (GRCh38)
Location 11:124879977-124879999
Sequence CTGCTGCCACAGGAGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090205183_1090205199 28 Left 1090205183 11:124879926-124879948 CCAGCGGGTGCTCCACCCAGATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1090205199 11:124879977-124879999 CTGCTGCCACAGGAGACTGTGGG 0: 1
1: 0
2: 0
3: 34
4: 262
1090205196_1090205199 -5 Left 1090205196 11:124879959-124879981 CCAGGGCAGGCAGGAGGGCTGCT 0: 1
1: 0
2: 4
3: 80
4: 731
Right 1090205199 11:124879977-124879999 CTGCTGCCACAGGAGACTGTGGG 0: 1
1: 0
2: 0
3: 34
4: 262
1090205190_1090205199 12 Left 1090205190 11:124879942-124879964 CCAGATGGTAAGCAGGGCCAGGG 0: 1
1: 0
2: 2
3: 27
4: 187
Right 1090205199 11:124879977-124879999 CTGCTGCCACAGGAGACTGTGGG 0: 1
1: 0
2: 0
3: 34
4: 262
1090205182_1090205199 29 Left 1090205182 11:124879925-124879947 CCCAGCGGGTGCTCCACCCAGAT 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1090205199 11:124879977-124879999 CTGCTGCCACAGGAGACTGTGGG 0: 1
1: 0
2: 0
3: 34
4: 262
1090205187_1090205199 16 Left 1090205187 11:124879938-124879960 CCACCCAGATGGTAAGCAGGGCC 0: 1
1: 0
2: 0
3: 9
4: 160
Right 1090205199 11:124879977-124879999 CTGCTGCCACAGGAGACTGTGGG 0: 1
1: 0
2: 0
3: 34
4: 262
1090205188_1090205199 13 Left 1090205188 11:124879941-124879963 CCCAGATGGTAAGCAGGGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 207
Right 1090205199 11:124879977-124879999 CTGCTGCCACAGGAGACTGTGGG 0: 1
1: 0
2: 0
3: 34
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090205199 Original CRISPR CTGCTGCCACAGGAGACTGT GGG Intronic
900144390 1:1151518-1151540 GTCCTGCCCCAAGAGACTGTGGG - Intergenic
900206168 1:1432780-1432802 CTGCTGGCACGGGGGACTGAGGG + Intergenic
900898978 1:5504099-5504121 CTTGTCCCAAAGGAGACTGTGGG + Intergenic
902082170 1:13828720-13828742 CTGCTGCCACAGAGGTCTATGGG - Intergenic
902167728 1:14585773-14585795 CTGCTGCCTCAGGAATCTTTCGG - Intergenic
902601095 1:17540428-17540450 CTCCTGCAGGAGGAGACTGTGGG + Intronic
904286216 1:29454705-29454727 ATGATACCACAGGAGGCTGTGGG + Intergenic
904372312 1:30057444-30057466 GTGCCGCCACAGCAGTCTGTGGG - Intergenic
908954469 1:69605305-69605327 CTCCAGCCACATGAAACTGTGGG + Intronic
913141218 1:115943087-115943109 ATGCTGCCACAGGGAACTGTTGG - Intergenic
915784034 1:158587669-158587691 CTGCTGCAACAGGGGAAAGTGGG - Intergenic
916009768 1:160694028-160694050 CCGCTGCCTGAGGAGACTGTAGG + Intronic
916056706 1:161073283-161073305 CTGCAGCCGGAGGAGAGTGTAGG - Exonic
919236743 1:194855325-194855347 CTCCTGCCTCAGGGGAATGTAGG - Intergenic
920811100 1:209286327-209286349 ATGCTGCAGCTGGAGACTGTTGG + Intergenic
920849492 1:209618925-209618947 CTGGTGCCACAGGAAGCTGCGGG + Intronic
922321947 1:224496266-224496288 TTCCTGCCTGAGGAGACTGTGGG + Intronic
922420091 1:225453813-225453835 CTGCTGCCAGATGAGAATCTGGG - Intergenic
922533507 1:226362761-226362783 CAGATGCCACAGGAGAATCTTGG - Intronic
922988668 1:229886483-229886505 CTAGCACCACAGGAGACTGTAGG - Intergenic
923121848 1:230999244-230999266 CTGCTTCAACAGGAGAGTGCAGG - Intronic
1063530889 10:6830433-6830455 CTGCTGCCTGAGGGTACTGTAGG - Intergenic
1064143287 10:12807810-12807832 CTGCAGCCAGAGGAGACAGGGGG - Intronic
1065883931 10:30060259-30060281 CCTCTGCCACAGGAGAGTATGGG - Intronic
1066048334 10:31613742-31613764 GTGCTGGCACAGGAGGCTGTAGG + Intergenic
1066750957 10:38656693-38656715 GTGCGGCCACAGGAGAATGATGG + Intergenic
1066966090 10:42266420-42266442 GTGCTGCCACAGGAGAATGATGG - Intergenic
1067726615 10:48775390-48775412 CAGCTGCCAGAGGAGGCTGCTGG + Intronic
1071733204 10:88269529-88269551 CTGCTGAAACAGGAGGCTCTGGG + Intergenic
1072009826 10:91292942-91292964 CTCAGGCCACAGGAGGCTGTAGG + Intergenic
1072147324 10:92653349-92653371 CTGCTGCCACAGGGGACATTTGG - Intronic
1072425512 10:95326802-95326824 CAGCAGCCACAGGTGGCTGTTGG + Intronic
1072807541 10:98434004-98434026 CTGCTCCCGCAGGCGGCTGTAGG + Exonic
1073073800 10:100810792-100810814 CTCCTGCCACAGGAGACCCAGGG + Intronic
1074535339 10:114324909-114324931 CTCCTGGCCCAGGAGACAGTGGG + Intronic
1075960131 10:126561431-126561453 CAGCTCACAGAGGAGACTGTGGG + Intronic
1076045806 10:127293414-127293436 CTGCTGTCATTGGACACTGTGGG + Intronic
1076220507 10:128729798-128729820 CTTCTGCCACAGGAGGTTGATGG + Intergenic
1076721672 10:132396005-132396027 CTGGTGCCACTGGGGACCGTCGG - Intergenic
1077304965 11:1864876-1864898 CCCCTGGCACAGGAGTCTGTGGG - Intronic
1077374418 11:2198834-2198856 CTGCAGGCACAGGTGACTTTTGG - Intergenic
1081643746 11:44776043-44776065 CTGCTGGCAGAGGATCCTGTGGG + Intronic
1083738521 11:64695206-64695228 CTGATGCCACAGGTGGATGTGGG - Intronic
1083823115 11:65183462-65183484 CTCCTGCCCCAGGGGACTGCTGG + Exonic
1084691831 11:70732081-70732103 CTGGGGCCACAGGAGTCTGATGG - Intronic
1084708992 11:70832419-70832441 CTGCTGCCACGGGAGCCCTTAGG - Intronic
1087208729 11:95424420-95424442 ATGCTTCCACTGGAGACTGGAGG - Intergenic
1090205199 11:124879977-124879999 CTGCTGCCACAGGAGACTGTGGG + Intronic
1090805555 11:130199936-130199958 CTGCTCCCTCTGCAGACTGTGGG + Exonic
1091658393 12:2362734-2362756 CTGCAGCCACAGGAGAGAGAGGG - Intronic
1091679479 12:2516517-2516539 CTGCTGCCTCAGGAGATGCTGGG + Intronic
1092047006 12:5438676-5438698 CTGCTGCCTCAGGCTACTGAAGG - Intronic
1096544503 12:52328301-52328323 CTGCTTCCAGAGGACACTGCTGG - Intergenic
1096887336 12:54731019-54731041 CTGCTGCCACAGGGTCCTGCTGG - Intergenic
1099166869 12:79317628-79317650 CTGTTGTCAGAGGTGACTGTCGG + Intronic
1099964697 12:89433317-89433339 CTGATGACACAGGAGAGTGAGGG + Intronic
1100665708 12:96750273-96750295 CTGCTGCTGCAGGAGACAGGTGG - Intronic
1101119405 12:101563725-101563747 CTGCTGCTACAGAAGACAGCGGG - Intergenic
1101659463 12:106753054-106753076 CTGCTGCTAGAGGAGGCTTTCGG + Intronic
1103150880 12:118637571-118637593 CTGCTGCCAGAGGAAGCTCTTGG - Intergenic
1104918947 12:132280652-132280674 CTGCTGGCTCAGGAGTCTGGGGG - Intronic
1105329528 13:19402730-19402752 TGCCCGCCACAGGAGACTGTGGG - Intergenic
1105717543 13:23082157-23082179 CTGCTTCCCCAGGAGAATGGCGG - Intergenic
1106553045 13:30787993-30788015 CTGCAGCCACAGGTGACTCCAGG - Intergenic
1106925384 13:34607776-34607798 CTGATACCACAGGAGGCTGCAGG - Intergenic
1107699323 13:43032228-43032250 CAGCTGACACAAGAGCCTGTAGG + Intronic
1108200600 13:48039228-48039250 CAGATGCCACAAGAGACTGCTGG - Intronic
1110990803 13:82039872-82039894 GAGCTGCCACTGGAGAGTGTTGG + Intergenic
1111410517 13:87871332-87871354 CAGTTTCCACAGGAGACTATTGG - Intergenic
1113023160 13:105911186-105911208 CTCCTGCCTCAGGAGAATATTGG + Intergenic
1114901102 14:27059039-27059061 ATGCTGCCTCAGAAGACTCTGGG - Intergenic
1115125677 14:29989967-29989989 CTGCTGATACAGGTGGCTGTAGG - Intronic
1117638642 14:57774265-57774287 CTCCTCCCACAGGAGTCAGTGGG - Intronic
1119163985 14:72477112-72477134 CAGCTCCCACAGCGGACTGTGGG - Intronic
1120574668 14:86167709-86167731 CTGCTGCCTCCGGAGGCTCTAGG - Intergenic
1121392187 14:93585088-93585110 AAGCTGCCACAGGAGCCTGGAGG - Intronic
1122488352 14:102096330-102096352 CTGCTGCCCCTGGAGGCTGGAGG - Intronic
1124405859 15:29391038-29391060 CAGCTGCTCCAGGAGGCTGTAGG - Intronic
1125908551 15:43415731-43415753 CTGCTGCTACTGGAGGCAGTAGG + Exonic
1126837151 15:52679078-52679100 CGGCTGCCTCAGGTGACCGTGGG + Intronic
1127233750 15:57024637-57024659 CTGCTGCCAAAGGAGCTTGCCGG + Intronic
1127453552 15:59138733-59138755 CAGGTGCCACAGAAGCCTGTAGG + Intronic
1128114839 15:65098732-65098754 CTGTAGCCACATGAGACTGCAGG + Intronic
1129065497 15:72900602-72900624 CTGCTCCCACAGAACACTGCAGG - Intergenic
1129826033 15:78635635-78635657 CTGCTGCCACAGGCTGCAGTGGG - Intronic
1129918777 15:79300044-79300066 ATGCTGCCAGAGGAGACAGATGG - Intergenic
1131217600 15:90552117-90552139 CTGCTGCCACAGCAGGCGCTCGG - Intronic
1132585342 16:703756-703778 TTGCTGCCCCAGCAGACTGAGGG + Intronic
1133694212 16:8245231-8245253 CCCCTCACACAGGAGACTGTTGG - Intergenic
1134225196 16:12384797-12384819 CTACTGCCCCAGAAGTCTGTGGG - Intronic
1134446224 16:14333373-14333395 CTGCTGGCCCAGGAGACCCTTGG + Intergenic
1134833543 16:17343230-17343252 TGGCTGTCACAGGAGATTGTGGG - Intronic
1136006599 16:27334629-27334651 TCTCTGCCACAGGATACTGTGGG + Intronic
1136277937 16:29190632-29190654 CTGGTGCTCCAGGAGTCTGTAGG - Intergenic
1136731767 16:32420418-32420440 GTGTTGCCACAGGAGAATGATGG - Intergenic
1137053944 16:35734643-35734665 CTGGTGCCACAGCAGCCTGAGGG + Intergenic
1137611647 16:49822100-49822122 CTCCTGATACAGGAGACTGTGGG + Intronic
1138030316 16:53554751-53554773 GTGCTTCTACAGGAGAGTGTGGG - Intergenic
1138511772 16:57512855-57512877 CTGCTGCCTGCGGAGCCTGTGGG + Exonic
1139338916 16:66254318-66254340 CAGCTGACACAGGAGCCTCTGGG + Intergenic
1139572561 16:67822335-67822357 CTCCAGCCTCAGGAGACTTTTGG - Intronic
1141436084 16:84000704-84000726 ATGCTGCAACAGGAGATGGTCGG - Exonic
1141510815 16:84510948-84510970 CTGCTGCCCCAGTAGGCTCTTGG + Intronic
1142307329 16:89293079-89293101 CTGCTTCTCCAGGCGACTGTGGG - Intronic
1202994624 16_KI270728v1_random:96836-96858 GTGCTGCCACAGGAGAATGATGG + Intergenic
1203021311 16_KI270728v1_random:409178-409200 GTGCTGCCACAGGAGAATGATGG + Intergenic
1142744638 17:1949716-1949738 CTGCACCCCCAGGAGAATGTAGG - Intronic
1143377719 17:6477249-6477271 CTGTTGTCACGGGAGACTCTGGG + Intronic
1143727699 17:8860711-8860733 TTGTTGCCACACGAGATTGTGGG - Intronic
1145282815 17:21480101-21480123 CAGCTTCCACGGGAGACTGGAGG + Intergenic
1146980619 17:37158156-37158178 CTGTTGAGACAGAAGACTGTGGG + Intronic
1147427025 17:40350776-40350798 GTCCTGCCACAGGAGGCTGGGGG + Intronic
1148138293 17:45309948-45309970 CATCTGCCAGTGGAGACTGTTGG + Intronic
1149098427 17:52872802-52872824 CTGCTGCAACACGAGACTTGTGG - Intronic
1150617678 17:66784821-66784843 CTGCTGACACAGGTGGCCGTCGG + Intronic
1152570003 17:81117586-81117608 CAGCTGCCAAAGGAGAGTGGGGG - Exonic
1152640442 17:81447196-81447218 CTGCAGCCCCAGGAGCCTGGAGG + Exonic
1203170056 17_GL000205v2_random:140451-140473 TTGCAGCCACAGGGGACTGAGGG + Intergenic
1153517725 18:5919813-5919835 CTGCTGCTAGGAGAGACTGTTGG - Intergenic
1155725374 18:29075244-29075266 CTGCTGTCACAGAATACTATGGG + Intergenic
1155845115 18:30695758-30695780 TTGCTCCCATAGGAGACTTTAGG - Intergenic
1156055478 18:32998112-32998134 CTGCTGCCAGAGGATAGTGGAGG - Intronic
1156518461 18:37700834-37700856 CTCCTACCCCAGGACACTGTGGG - Intergenic
1157831766 18:50862577-50862599 CTGCTTTCACAGGAGTCTGCAGG + Intergenic
1160618975 18:80156731-80156753 CTCCTGCCTCATCAGACTGTGGG + Intronic
1161316595 19:3620273-3620295 CTGCAGGCACAGGAGGCTGAGGG + Intronic
1162177609 19:8842873-8842895 CTGCTGGCAGAGGAGACTGCAGG + Exonic
1162805448 19:13135873-13135895 CTGCCACCACCGGAGCCTGTTGG - Exonic
1163322223 19:16581500-16581522 CTGCTGCTTCAGGAGTATGTGGG - Intronic
1164154042 19:22578111-22578133 CCGCTGCCTGAGGGGACTGTAGG + Intergenic
1164741930 19:30582254-30582276 CTACTGCCAAGGGAGCCTGTGGG + Intronic
1165161718 19:33820471-33820493 CTGCTGCCACCTGGGGCTGTGGG - Intergenic
1166312209 19:41969322-41969344 ATGCTGCCATGGGAGACTGAGGG + Intronic
1166424286 19:42662097-42662119 CTCCTGTCACAGGAGACTTGAGG + Intronic
1168332408 19:55578260-55578282 CTGGTGGCGCAGGAGGCTGTAGG + Exonic
925338172 2:3114021-3114043 CTTGTGTCACAGGAGACTTTGGG + Intergenic
926999657 2:18780635-18780657 TTGTTGCCACAGGAGCCTGCAGG + Intergenic
927449294 2:23193130-23193152 CTCCTCCCAAAGGACACTGTGGG + Intergenic
928192548 2:29186183-29186205 CTCCTGACACAGGAGTCTATTGG - Intronic
932634557 2:73377115-73377137 CTGTTGGCACAGGAAGCTGTTGG - Intergenic
933852817 2:86384850-86384872 CAGCTGCCACAGGATGCTCTAGG - Intergenic
934313955 2:91898845-91898867 GTGCTGCCACAGGAGAATGATGG + Intergenic
934655016 2:96112802-96112824 CTGCTGGCACAGCAGACTCTGGG - Intergenic
936151403 2:110024160-110024182 CCGCTGCCCCAGGCCACTGTAGG + Intergenic
936157633 2:110058851-110058873 CTGCTGCCACAGGATCCACTTGG - Intergenic
936187059 2:110312593-110312615 CTGCTGCCACAGGATCCACTTGG + Intergenic
936193272 2:110347209-110347231 CCGCTGCCCCAGGCCACTGTAGG - Intergenic
936539788 2:113340846-113340868 TTGCTGCTAGAGGAGGCTGTGGG + Intergenic
937238345 2:120443970-120443992 CATCTCCCACAGGAGACAGTGGG - Intergenic
941185781 2:162319696-162319718 CTGTAGCCACATGTGACTGTGGG + Intronic
945021979 2:205582876-205582898 CAGCTGTCACAGGGAACTGTAGG - Intronic
946956891 2:224940681-224940703 CTGCTGTCATAGGAGAGTGATGG - Intronic
947298824 2:228665401-228665423 CTGATGCCCCAGGATGCTGTGGG + Intergenic
947981768 2:234416582-234416604 CTGCTGCCGCAGTACACTGAGGG - Intergenic
948143063 2:235688548-235688570 ATCCTGCCACATGAGACTGCAGG + Intronic
948374032 2:237509254-237509276 CTGCTGCCCCAGGACACTTCTGG + Intronic
948746252 2:240096053-240096075 CTGCTGCCAGCGAACACTGTGGG + Intergenic
1168895581 20:1321263-1321285 CTGGTGGCACAGGAAACTGAGGG + Intronic
1168948378 20:1780031-1780053 CTGGTGCCACTGGTGCCTGTGGG - Intergenic
1172331519 20:34079033-34079055 CTGCAGCCACAGGAGGCTCTTGG - Intronic
1172662191 20:36574975-36574997 TTGCTGCCACAGGTCACTGAGGG + Intronic
1172884059 20:38219675-38219697 CAGCTTCCCCAGGAGGCTGTTGG + Exonic
1173837861 20:46137485-46137507 ATGCAGCCCCAGGAGACTCTGGG + Intergenic
1175823605 20:61924775-61924797 CTGATGCCCCTGGAGGCTGTGGG - Intronic
1176326051 21:5502247-5502269 TTGCAGCCACAGGGGACTGAGGG + Intergenic
1176331656 21:5553936-5553958 TTGCAGCCACAGGGGACTGAGGG - Intergenic
1176396101 21:6267015-6267037 TTGCAGCCACAGGGGACTGAGGG + Intergenic
1176401706 21:6318704-6318726 TTGCAGCCACAGGGGACTGAGGG - Intergenic
1176435451 21:6670400-6670422 TTGCAGCCACAGGGGACTGAGGG + Intergenic
1176441056 21:6722089-6722111 TTGCAGCCACAGGGGACTGAGGG - Intergenic
1176459713 21:6997470-6997492 TTGCAGCCACAGGGGACTGAGGG + Intergenic
1176465318 21:7049158-7049180 TTGCAGCCACAGGGGACTGAGGG - Intronic
1176483274 21:7379248-7379270 TTGCAGCCACAGGGGACTGAGGG + Intergenic
1176488879 21:7430936-7430958 TTGCAGCCACAGGGGACTGAGGG - Intergenic
1177456134 21:21342533-21342555 CTGCTGCCACAAAAGACAGCAGG - Intronic
1177906713 21:26980270-26980292 CTCCTGCCAGAGGAGACACTAGG - Intergenic
1178342707 21:31799926-31799948 CTGCTGCCACAGGAGTTGGGGGG + Intergenic
1178802668 21:35810710-35810732 CTACTGCCCCATGTGACTGTGGG - Intronic
1179463199 21:41551758-41551780 CTGCTGCCCCAGGAGTGGGTGGG + Intergenic
1179983046 21:44906305-44906327 CTGCCGCAGCAGGAGAATGTTGG + Intronic
1180540706 22:16444743-16444765 GTGCTGCCACAGGAGAATGATGG + Intergenic
1181512871 22:23396578-23396600 CTGCTGGCACAGGGCCCTGTAGG - Intergenic
1181597016 22:23922382-23922404 CTGCTGCCACAGGATTCAATTGG - Intergenic
1182759022 22:32706973-32706995 ATGCTGACACAGGAGACAATAGG - Intronic
1184037644 22:41926277-41926299 CTGCAGCCGCAGGAGTCGGTGGG - Exonic
1184763254 22:46557570-46557592 GTGCTGACAGGGGAGACTGTTGG + Intergenic
1184994220 22:48193033-48193055 CAGCTGCCACAGGAGTCCCTAGG - Intergenic
949840581 3:8315658-8315680 CAGCTACCACAGCAGAGTGTAGG + Intergenic
950467387 3:13163354-13163376 CTGCTGCCAGAGGGGACTGGGGG + Intergenic
952858148 3:37790317-37790339 CTGCTCTCACAGGAGGCTGTTGG + Intronic
953568567 3:44053712-44053734 CTGTTGCCACAGGAGCTAGTGGG - Intergenic
953964722 3:47295359-47295381 CTGATGCAAGAGGACACTGTGGG - Intronic
954292105 3:49655188-49655210 CTGCTCCCAGAGGAGCCTGCGGG + Exonic
954366054 3:50146790-50146812 CTGCTGTCTCAGGAGAGTGGGGG + Intergenic
955197988 3:56823165-56823187 CTGCTGCAAGAGGAAACTATAGG - Intronic
956700271 3:71952627-71952649 CTGGTGCCAGTGGAGGCTGTGGG + Intergenic
962089734 3:132230524-132230546 CTGCTTCCAGAGCAGCCTGTTGG + Intronic
964024402 3:152054699-152054721 CTGCTCCCCCTGAAGACTGTAGG - Intergenic
965930222 3:174032922-174032944 CTGCAGCCAGAGAAGACAGTGGG + Intronic
966942432 3:184755480-184755502 CTCCTGCCACTGGAGAGTGTAGG - Intergenic
967171087 3:186824431-186824453 CTGGTGCCACAGGTGAGGGTGGG - Intergenic
968611444 4:1558983-1559005 CTGCTGCCAAGGGAGACTCACGG - Intergenic
968907433 4:3461175-3461197 CTGCTGTGACCTGAGACTGTGGG + Intergenic
969430888 4:7153729-7153751 CTGCTGCCTCCAGAGACTGCAGG + Intergenic
969632698 4:8347609-8347631 CTGGTGCCACAGAACACAGTTGG - Intergenic
970608162 4:17701702-17701724 CTGCTGCCCCTGGATACTGCAGG - Intronic
973589957 4:52431054-52431076 CTGCTGCCTTATGTGACTGTTGG + Intergenic
974417514 4:61628897-61628919 GTGCTGCCACAGGATAGTATTGG + Intronic
974638357 4:64595197-64595219 CTGCTGCTACAGAAAACTATGGG + Intergenic
974888683 4:67852050-67852072 CTGTTGGCACAGAAGACTGAAGG - Intronic
975579599 4:75894764-75894786 CTGCTACCACAGGGGCCGGTAGG - Intronic
977946166 4:102916923-102916945 GTGCTGCCACAGGAGAATGATGG + Intronic
980500069 4:133638840-133638862 CTGCGGGTACAGGAGAATGTAGG - Intergenic
980693003 4:136320257-136320279 CTGCTGACTAAGGAGACTTTGGG + Intergenic
981770529 4:148303276-148303298 CAGCTGCAACTGGAGATTGTTGG - Intronic
984646017 4:182220501-182220523 GTGATGCCAGAAGAGACTGTAGG - Intronic
985718574 5:1476555-1476577 CTGCTGCAGCAGGAGCCTGGGGG + Intronic
986564697 5:9100411-9100433 CTGAAGCCCCAGGAGACTGCTGG + Intronic
989465634 5:41752040-41752062 CAGCTGCCATAGCATACTGTAGG - Intronic
995181190 5:109231661-109231683 CAGCTGCCCCAGGAGACTGAAGG + Intergenic
997716937 5:136049432-136049454 ATGCAGCCACAGCAGCCTGTGGG - Exonic
998771640 5:145552347-145552369 CTGCTGCCACACAAGACTTTGGG + Intronic
998903431 5:146878750-146878772 CTGCTGCTGCAGGAGGCTGGAGG + Intronic
1000093844 5:157953494-157953516 CTAGGGCCACAGGAGACTGTGGG + Intergenic
1000201983 5:159020183-159020205 CTGCTGCCTCATGGGAATGTGGG - Intronic
1000292366 5:159882347-159882369 CTGCTGCCAGAGGATGCTGGTGG - Intergenic
1000302811 5:159971592-159971614 GTGCTGCCAGAGGAAACTATAGG + Intronic
1001873612 5:175180129-175180151 CTGAAGCCACAGGAGACTCTTGG - Intergenic
1002928255 6:1617517-1617539 CTGCCCCCACAGAAGGCTGTGGG + Intergenic
1004427502 6:15516446-15516468 CTGAGGCCACAGGAGAGTGCTGG - Intronic
1007562471 6:42821438-42821460 CTGCTGCAAAAGGAGAATGTGGG + Intronic
1008025361 6:46629850-46629872 CTCCTGGCCCAGGAAACTGTTGG + Intronic
1012028507 6:94028912-94028934 CTGCTGCTGCAGGACAATGTGGG - Intergenic
1012243224 6:96897673-96897695 CTGCTCTCGCAGGAGGCTGTTGG + Exonic
1016019535 6:139221196-139221218 CTGATGCCCCATGAAACTGTGGG - Intergenic
1018198718 6:161376724-161376746 CGGTTGCCACAGAAGACTGAGGG - Intronic
1018231081 6:161676142-161676164 CTGGTGCCACTAGAAACTGTGGG + Intronic
1018811584 6:167301957-167301979 CTGCTGCCACAGGTGTTTCTTGG - Intronic
1019873676 7:3790347-3790369 GAGCAGCCACAGGAGACTGGAGG - Intronic
1020024151 7:4886856-4886878 CTCCAGCCCCAGGAGACTTTAGG + Intergenic
1021525901 7:21587539-21587561 CTGTAGCCCCAGGACACTGTTGG + Intronic
1022522634 7:31017813-31017835 CTGCTGCCACAGGAGGTTCTGGG + Intergenic
1023524267 7:41082698-41082720 CTGCAGGCAGAGGAGATTGTGGG - Intergenic
1025634632 7:63311753-63311775 CTTCTGCAACAGGACACTGTTGG + Intergenic
1025648064 7:63436417-63436439 CTTCTGCAACAGGACACTGTTGG - Intergenic
1026131623 7:67625693-67625715 CTGCTCCCAGGGGAGACTGTAGG + Intergenic
1026548077 7:71341920-71341942 CTGCATCCACAGGAGCCTCTAGG - Intronic
1027182481 7:75950548-75950570 CTGCTGCCTCATGACTCTGTGGG + Intronic
1027555452 7:79659279-79659301 CTGCTGCCACAGGAGTATGATGG + Intergenic
1028175919 7:87657900-87657922 CTGCTCCCACAGGGGAAGGTGGG - Intronic
1028658088 7:93233736-93233758 CAGCTGCCACAGGATACAGCAGG - Intronic
1029421773 7:100475735-100475757 CTGCTGCCCCCAGAGCCTGTTGG - Intronic
1032268674 7:130385139-130385161 CTGCTGGCTCCGGACACTGTGGG - Exonic
1033673041 7:143511436-143511458 CTGCTGCCTCAGGGGACTGGCGG - Intergenic
1034426225 7:151015679-151015701 CGGCAGCCACAGGAGATTGGAGG - Intronic
1034593203 7:152162258-152162280 CTGCTGCCAAAGGAGACTCAGGG - Exonic
1042392432 8:68251419-68251441 CTGCAGCCACTGGAGACTGGAGG + Intergenic
1045405284 8:101860228-101860250 CTGCTGCCTCAGGAAACTACCGG + Intronic
1049127808 8:140808194-140808216 CTGCTGCTACAGGAAAGAGTGGG + Intronic
1049388550 8:142356419-142356441 CTGCTGCCCCAGGGGAGAGTGGG + Intronic
1049450494 8:142658934-142658956 CTGTTGTTTCAGGAGACTGTGGG - Exonic
1050339918 9:4626349-4626371 CTGGTGCCACAGGAGCTTGGAGG - Intronic
1053570004 9:39295022-39295044 CTGCTACAACAGGAAACTATAGG - Intergenic
1053835964 9:42136051-42136073 CTGCTACAACAGGAAACTATAGG - Intergenic
1054091633 9:60854025-60854047 CTGCTACAACAGGAAACTATAGG - Intergenic
1054113048 9:61129599-61129621 CTGCTACAACAGGAAACTATAGG - Intergenic
1054127145 9:61323988-61324010 CTGCTACAACAGGAAACTATAGG + Intergenic
1054594668 9:67052593-67052615 CTGCTACAACAGGAAACTATAGG + Intergenic
1055911594 9:81359005-81359027 CTCATGCCTCAGGAGCCTGTGGG - Intergenic
1056931689 9:90883197-90883219 CTGCTGCTACAGGCTGCTGTGGG + Intronic
1057047283 9:91895968-91895990 CAGCTGCCACAGGTGTCTGGTGG - Intronic
1057470275 9:95350415-95350437 CTGCAGCCACAGCCGTCTGTTGG + Intergenic
1059157472 9:112002771-112002793 CTGCAGCCACACCAGACTGGAGG + Intergenic
1059405096 9:114094440-114094462 GCTTTGCCACAGGAGACTGTAGG + Exonic
1059952190 9:119477438-119477460 CCGATGCCACAGCAGCCTGTAGG + Intergenic
1059996461 9:119915015-119915037 CTGATGCTACAGGATACTTTTGG - Intergenic
1061054232 9:128213920-128213942 CTGCTGCCCCAGGGGACCCTAGG - Intronic
1061598212 9:131646520-131646542 GTGCTGCCACAGGAGATGGCGGG + Intronic
1062039029 9:134395746-134395768 CTGCCTCCACAGGAGCCTGAGGG - Intronic
1062645930 9:137548120-137548142 CTGCTGCTCCAGGAGACTGCAGG - Intronic
1203430443 Un_GL000195v1:86398-86420 TTGCAGCCACAGGGGACTGAGGG + Intergenic
1203436077 Un_GL000195v1:138240-138262 TTGCAGCCACAGGGGACTGAGGG - Intergenic
1186618760 X:11215488-11215510 CTGCTCCCACAGGAGACTCGGGG + Intronic
1188693195 X:33155632-33155654 ATGCTACCACAGGAGGCTCTGGG + Intronic
1189494894 X:41499928-41499950 CTCCTGCCACAGGTGTCTGTGGG - Intergenic
1189675717 X:43458602-43458624 CTGCTGCCACAGGATCCCATTGG - Intergenic
1190246591 X:48694968-48694990 CTGCTGCCCGAGGAGACTGGGGG + Intergenic
1192549319 X:72041565-72041587 CTGCAGCCTCAGGAGAGTGGAGG + Intergenic
1194370746 X:93068865-93068887 CTGCTGCTACTGGAGAATGAGGG - Intergenic
1195161866 X:102179412-102179434 CTGCTGCCTCTGGAAACAGTGGG - Intergenic
1195270240 X:103221326-103221348 CTGCTGCGACAGGGTACTGATGG - Intergenic
1195567928 X:106363732-106363754 TTGCTCCCATAGGAGACTTTAGG - Intergenic
1195691627 X:107630643-107630665 CTGCTCCCCCAGGTGACTCTTGG + Intronic
1200002340 X:153068555-153068577 CTGCTGCCACAGAAGGTTCTTGG + Intergenic
1200005384 X:153081455-153081477 CTGCTGCCACAGAAGGTTCTTGG - Intergenic
1200678541 Y:6180755-6180777 CTGCTGCTACTGGAGAATGAGGG - Intergenic
1201181866 Y:11356332-11356354 GTGCTGCCACAGGGGAATGATGG + Intergenic