ID: 1090205313

View in Genome Browser
Species Human (GRCh38)
Location 11:124880515-124880537
Sequence CAGCAGCTCTAGGGGCTCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 353}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090205306_1090205313 2 Left 1090205306 11:124880490-124880512 CCGGCAGCAACTCTTCCAGGGGC 0: 1
1: 0
2: 1
3: 49
4: 216
Right 1090205313 11:124880515-124880537 CAGCAGCTCTAGGGGCTCCCGGG 0: 1
1: 0
2: 1
3: 42
4: 353
1090205302_1090205313 8 Left 1090205302 11:124880484-124880506 CCACGGCCGGCAGCAACTCTTCC 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1090205313 11:124880515-124880537 CAGCAGCTCTAGGGGCTCCCGGG 0: 1
1: 0
2: 1
3: 42
4: 353
1090205298_1090205313 28 Left 1090205298 11:124880464-124880486 CCAGGGCACCAGCACATGTTCCA 0: 1
1: 0
2: 0
3: 23
4: 241
Right 1090205313 11:124880515-124880537 CAGCAGCTCTAGGGGCTCCCGGG 0: 1
1: 0
2: 1
3: 42
4: 353
1090205301_1090205313 20 Left 1090205301 11:124880472-124880494 CCAGCACATGTTCCACGGCCGGC 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1090205313 11:124880515-124880537 CAGCAGCTCTAGGGGCTCCCGGG 0: 1
1: 0
2: 1
3: 42
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090205313 Original CRISPR CAGCAGCTCTAGGGGCTCCC GGG Exonic
900099328 1:954458-954480 CAGCACCTCTGGGGTCGCCCAGG + Intronic
900145774 1:1158138-1158160 CCGCAGCTCCAGAGGCTCCTGGG + Intergenic
900368065 1:2319551-2319573 CAGGCGCTCACGGGGCTCCCAGG + Intergenic
900546094 1:3230066-3230088 CTGCAGCTCTCTGGGATCCCTGG + Intronic
900678115 1:3901038-3901060 GAGCAGCGCGAGGGACTCCCAGG + Intergenic
900701106 1:4049150-4049172 CAGCACAGCCAGGGGCTCCCAGG - Intergenic
901744432 1:11363140-11363162 CACTAGCTCTAGTGGATCCCTGG - Intergenic
901836316 1:11926203-11926225 CAGCGGCTCAAGGGGCTGCCGGG - Exonic
902057756 1:13616586-13616608 AAGCAACTCTAGAGGCTGCCTGG - Exonic
902087980 1:13877814-13877836 CAGCAGCACCAGTGTCTCCCGGG + Intergenic
902824331 1:18962630-18962652 CAGCAGCCCTGGGGGAGCCCTGG + Intergenic
902882585 1:19382611-19382633 CACCAGCTCTGGGGGATCTCAGG - Intronic
903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG + Intergenic
903326686 1:22572905-22572927 CAGCAGCTCCCGGGGCTGGCAGG + Intronic
903673455 1:25050110-25050132 GGGCAGCTCTAGGGGCTCCTGGG + Intergenic
904039822 1:27577341-27577363 CGGCAGCTAGAGGGGCCCCCAGG + Intronic
904928539 1:34067507-34067529 CAGGAGCCCCAGGGGCTGCCAGG + Intronic
905883985 1:41481977-41481999 CAGCAACTCTGGGGCCACCCTGG + Intronic
905889492 1:41510597-41510619 CAGCAGCTCTGTGGGCTGCCTGG - Exonic
905974629 1:42165551-42165573 CAGCAGCTCCTGGTCCTCCCTGG + Intergenic
906038463 1:42767436-42767458 CAGCCGGTCTCGGGGCTCCGCGG + Intronic
906220266 1:44072792-44072814 CAGAGGCTCTGGGGGCTCCTGGG - Intergenic
906380846 1:45331498-45331520 AAGCTGCTCTGAGGGCTCCCAGG + Exonic
907663151 1:56412002-56412024 CCTCAGCACCAGGGGCTCCCTGG + Intergenic
908984445 1:69999950-69999972 CAGCAGCTTTCTGGGCTCCCAGG - Intronic
910596101 1:88982704-88982726 CAGCACCTCTTGGTGCTCCGCGG + Exonic
911050884 1:93670248-93670270 CAGCAGGTTTAAGAGCTCCCTGG + Intronic
912250945 1:108011965-108011987 GAGCAGCTCTCAGGTCTCCCTGG + Intergenic
912489642 1:110055007-110055029 CTGCTGCTCTAGGTCCTCCCTGG + Intronic
917231635 1:172844053-172844075 CAGAAGCTCTAGGGAATACCAGG + Intergenic
918589505 1:186224459-186224481 CAGCAGGTCTATGGGGTCCTAGG - Intergenic
918756025 1:188340167-188340189 CATCACCTCTAGGGGCTCGCCGG + Intergenic
919880211 1:201896028-201896050 CAGCTGCTCCAGGGGTGCCCTGG - Intergenic
920011813 1:202873585-202873607 CAGCAGCACTGGGTGCTCCTTGG - Intergenic
921988910 1:221342812-221342834 CAGGAGCTCCAGAGGATCCCAGG + Intergenic
922865956 1:228861720-228861742 CCGGAGCTCTGGGCGCTCCCAGG + Intergenic
923499071 1:234549804-234549826 CAGCAGCCCTGGGGCCTGCCTGG + Intergenic
1065627223 10:27643267-27643289 CAGCAGCTGAAGTGGCTTCCAGG - Intergenic
1067473174 10:46550391-46550413 CAGCAGCACTAGGGGCCCGCAGG + Exonic
1068096421 10:52497773-52497795 TATCAGCTCTAGGAGCTTCCTGG + Intergenic
1070805609 10:79269015-79269037 AGGCAGCTCGAGGTGCTCCCTGG + Intronic
1073101447 10:101008731-101008753 CACAAGCTCCATGGGCTCCCGGG + Intronic
1073435419 10:103513154-103513176 CAGCAGACCTGGGGGCTGCCAGG - Intronic
1074938321 10:118209309-118209331 TGGCAGCTCCAGGGCCTCCCTGG - Intergenic
1076002932 10:126926773-126926795 CAGCAGCCCGTAGGGCTCCCTGG + Intronic
1076496675 10:130901918-130901940 CAGCTCCTCCAGAGGCTCCCCGG - Intergenic
1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG + Intronic
1076813065 10:132899156-132899178 CAGCAGCTCCAGGTGGGCCCAGG - Intronic
1077047263 11:552091-552113 CAGCTGCTCGGGGGGCTCCCTGG - Exonic
1077313264 11:1902797-1902819 CAGCAGCTCTCGGGGCTGCTCGG - Intergenic
1077382358 11:2250081-2250103 CACCAGCTCAACGGACTCCCAGG + Intergenic
1077478816 11:2803458-2803480 CAGGAGCTTTAGGGGTACCCAGG + Intronic
1081812757 11:45922709-45922731 CACCTGCTCCAGCGGCTCCCGGG - Intronic
1083365527 11:62139578-62139600 CAGCAGCCCTTGGGGCTGCAGGG - Intronic
1084235958 11:67788194-67788216 CTGCAGGTCTCGGGGCTCCTGGG + Intergenic
1084509282 11:69593202-69593224 CAGCGGCTCTGGCAGCTCCCCGG + Intergenic
1084782379 11:71418743-71418765 CTGCAGCTCCCGGGGCTCCTGGG - Intergenic
1085446595 11:76604881-76604903 CTGTAGCTCTAGGGGGTCCCGGG - Intergenic
1085623914 11:78057582-78057604 CAGCTACTCTTGGGGCACCCTGG + Intronic
1085747264 11:79125851-79125873 CCTCACCTCTAGGGGCTCGCTGG - Intronic
1085812365 11:79695704-79695726 CTGCAGCTATGGGGACTCCCGGG + Intergenic
1088249280 11:107848840-107848862 GAGGAGCTCTTGGGGTTCCCTGG - Intronic
1089015004 11:115158327-115158349 AAGCAGTTCCAGGGACTCCCTGG + Intergenic
1089630821 11:119783119-119783141 CTGCAGCTCTAGTGTCACCCAGG + Intergenic
1089688245 11:120170251-120170273 CAGAGGGTCCAGGGGCTCCCGGG - Exonic
1089702773 11:120255360-120255382 CCGCACCTCTCTGGGCTCCCCGG - Intronic
1090205313 11:124880515-124880537 CAGCAGCTCTAGGGGCTCCCGGG + Exonic
1090250616 11:125248361-125248383 CAGCAGCTCTGTCGGGTCCCAGG + Intronic
1091343601 11:134838260-134838282 CTGCAGCTCTCGGGCCTCCAGGG + Intergenic
1091594338 12:1865664-1865686 CAGCAGCACCAGGGGCAGCCGGG + Intronic
1092406865 12:8227557-8227579 CTGCAGGTCTCGGGGCTCCTGGG + Exonic
1093604178 12:21069919-21069941 CACCAGCTCTAGGGGCTTTTTGG + Intronic
1094831315 12:34301567-34301589 CAGCACCTACAGGGGGTCCCGGG + Intergenic
1095983700 12:47986407-47986429 CAGCGGGTCCAGGGGCTCCCTGG + Exonic
1096399276 12:51291749-51291771 CACCAGCCCTAGGGCCTCCTTGG - Exonic
1096519213 12:52174688-52174710 CAGCAGCAACAGGGGCTCCGGGG - Intronic
1096551877 12:52378354-52378376 CAGCAGCTCCCGGGGCGGCCTGG - Exonic
1099365628 12:81763066-81763088 CCTCACCTCTAGGGGCCCCCTGG - Intergenic
1099526072 12:83720751-83720773 CATCAGGTCTAGGGGCCCACTGG - Intergenic
1101879231 12:108615009-108615031 CAGCAGCTGTGGGAGCTCCAAGG + Intergenic
1102572324 12:113834452-113834474 CAGAAGCCCTAGGGGCTGCAAGG + Intronic
1102813443 12:115843454-115843476 CAGCAGCACTTGGGGCTGGCTGG + Intergenic
1103144424 12:118582343-118582365 CAGCAGCCCTCGGGGCTGCTCGG - Intergenic
1103701110 12:122849166-122849188 CAGCAGGTCTGGGGGAGCCCAGG - Intronic
1104942919 12:132403293-132403315 CGGCAGCTCCAGCGGCTGCCTGG - Intergenic
1104943233 12:132404543-132404565 CAGAAGCTCTTGGGGGACCCCGG - Intergenic
1107508574 13:41060254-41060276 CAGTAGCTCTAGTGGTTCTCTGG - Intronic
1108314201 13:49221428-49221450 CAGGAGCTCTGGGGGACCCCAGG + Intronic
1111693017 13:91588850-91588872 CAGCAGCTCCAATGGCTGCCAGG - Intronic
1113251026 13:108452754-108452776 TAGGAGCTCTCGGGGCTCCAGGG - Intergenic
1116082191 14:40188174-40188196 GCACAGCTCTAGGGCCTCCCTGG - Intergenic
1118261463 14:64251116-64251138 CCCCAGCTCTAGGCTCTCCCAGG + Intronic
1118787090 14:69054978-69055000 CAGCAGCTCTAGCAGCTCTGAGG - Exonic
1121599418 14:95191916-95191938 CAAAAGCTCGAGGGGCTGCCTGG - Intronic
1122115858 14:99526889-99526911 CAGCAGCTCCAGGGGCAGCTGGG + Intronic
1122325271 14:100877930-100877952 CAGCAGCTCCAGGAGCTCAAGGG - Intergenic
1122488071 14:102094967-102094989 CAGGAGCCCCAGAGGCTCCCGGG + Intronic
1122814651 14:104306557-104306579 CAGCCCCTCTGGGGGCTCCTGGG + Intergenic
1123215915 14:106809383-106809405 CAGCAGCTGTAGGACTTCCCAGG + Intergenic
1202899306 14_GL000194v1_random:26427-26449 TAGCAGCCCAAGGCGCTCCCTGG + Intergenic
1123439649 15:20281259-20281281 CAGCTGTTCGAGGGGCTGCCTGG + Intergenic
1124014173 15:25862433-25862455 CCGCAGCTAAAGGGGCGCCCTGG - Intronic
1124619499 15:31265753-31265775 CAGAAGCTCTGGGGAGTCCCTGG + Intergenic
1126446555 15:48752400-48752422 CAGCAGGTCCAGGGTCTCCTTGG + Exonic
1127982275 15:64044196-64044218 CATCAGCTCCAGATGCTCCCAGG + Intronic
1128000369 15:64185748-64185770 CAGCTGCTCTAGAGGCTGACAGG + Intronic
1128214265 15:65923437-65923459 CAGCAGCACCAGTGGCTCCTGGG - Intronic
1128841558 15:70854533-70854555 CCACAGCTCCAGGGGCTTCCAGG + Intronic
1128879084 15:71226618-71226640 AGTCAGCTCTAGGGGCCCCCAGG - Intronic
1129410941 15:75349943-75349965 CACCACCTCTCAGGGCTCCCAGG + Intronic
1130014344 15:80175377-80175399 CAGCCTCTCCAGGGGCTGCCTGG + Intronic
1130297545 15:82657786-82657808 CAGCAGCTCCAGCAGCTCTCTGG + Intergenic
1131091428 15:89627441-89627463 CAGCAGCTCAAGGGACCCCAGGG - Exonic
1131400640 15:92122991-92123013 TAGCAGCTCAGGAGGCTCCCTGG - Intronic
1131873610 15:96783281-96783303 CAGCAGCTCTGGGGTCTGCAGGG - Intergenic
1132660362 16:1058321-1058343 CAGGAGCTGTGGGGGGTCCCAGG + Intergenic
1132906708 16:2286209-2286231 CAGGAGCTCTGGGGGCTCTGTGG + Intronic
1133188154 16:4115259-4115281 CAGCAGCTCTGGGGACTCCGGGG - Exonic
1134522462 16:14924915-14924937 CAGCAGCACTGAGGGCTGCCTGG - Intronic
1134531951 16:14990126-14990148 CAGGGGCTCAAGGGGCTGCCGGG - Intronic
1134710132 16:16323566-16323588 CAGCAGCACTGAGGGCTGCCTGG - Intergenic
1134717346 16:16363566-16363588 CAGCAGCACTGAGGGCTGCCTGG - Intergenic
1134949471 16:18345079-18345101 CAGCAGCACTGAGGGCTGCCTGG + Intergenic
1134957406 16:18388593-18388615 CAGCAGCACTGAGGGCTGCCTGG + Intergenic
1135062946 16:19286376-19286398 CAGCAGCTCTGAAAGCTCCCTGG - Intronic
1135207974 16:20499104-20499126 CAGCAGCTTTCAGGGCTTCCAGG - Intergenic
1135210925 16:20524596-20524618 CAGCAGCTTTCAGGGCTTCCAGG + Intergenic
1135342972 16:21664389-21664411 CAGCGGCTTTAAGGGCTCCTGGG + Intergenic
1135625966 16:23995248-23995270 CAGAAGCTCTTGGGGCCCCTTGG - Intronic
1135876652 16:26206695-26206717 CAGCATCTCTAGGGTCTCATTGG + Intergenic
1136186088 16:28589918-28589940 CAGCACCTATAGGGGCTGCTGGG - Intronic
1136580207 16:31147080-31147102 CACCAGCTCCAGGGACGCCCAGG - Intronic
1136873464 16:33828697-33828719 CAGCAGCTGTAGGACTTCCCAGG - Intergenic
1137395376 16:48113377-48113399 CTCCAGCTCCAGGAGCTCCCGGG + Intronic
1138868226 16:60849579-60849601 CAGCAGGTCCAGTGGGTCCCTGG + Intergenic
1139280180 16:65763927-65763949 CACCAGCTCTAGGGCCACACAGG - Intergenic
1139436876 16:66941549-66941571 CAGCAGCTCCTGGGGGTGCCTGG - Exonic
1140141144 16:72259143-72259165 CTGCAGCCCTAGGTGCTCCTTGG - Intergenic
1140861908 16:79025525-79025547 CAGCAGCCCTCAGTGCTCCCTGG - Intronic
1141150959 16:81564485-81564507 CATCAACTCTAGGGGATTCCAGG - Intronic
1142136311 16:88453462-88453484 CGGCAGCTCCAGCGGCTCCGGGG + Exonic
1142306531 16:89289101-89289123 CAGGAGCTCCAGGGGCGCCCAGG + Intronic
1142429679 16:90019391-90019413 CCGCAGCTGTTGGGGCGCCCGGG - Intronic
1203098711 16_KI270728v1_random:1287358-1287380 CAGCAGCTGTAGGACTTCCCAGG + Intergenic
1142859050 17:2749788-2749810 CCGGGGCTCTCGGGGCTCCCGGG - Intergenic
1143036681 17:4003670-4003692 CAGCAGGACTGGGTGCTCCCAGG - Intergenic
1143628003 17:8122012-8122034 CCGCGGCTCCAGGGGTTCCCCGG - Exonic
1146653786 17:34623347-34623369 TAGCAGCTCTGGGGTCTCCAGGG + Intronic
1146796983 17:35788672-35788694 CAGAAGCTCCAGTGTCTCCCTGG + Intronic
1147562101 17:41515613-41515635 CAGCAGATCCAGGGGCTCATTGG - Exonic
1147701502 17:42398604-42398626 ACTCAGCTCTAAGGGCTCCCAGG - Intergenic
1148554535 17:48570443-48570465 CAGCAGCTCTGGAGGCAGCCAGG + Intronic
1148795854 17:50196313-50196335 CAGCAGGGCCAGGGGCTCCAGGG + Exonic
1149579337 17:57737658-57737680 CACCAGCACCAGGGGCTACCTGG + Intergenic
1150212742 17:63450361-63450383 CTGCAACCCTCGGGGCTCCCAGG + Intergenic
1151497318 17:74466652-74466674 CAGCAGCTCCAGGCCCTACCTGG - Exonic
1152482219 17:80562117-80562139 CAGGGGCTCTTGGGGCTGCCGGG - Intronic
1152649024 17:81483441-81483463 CAGCAGCTGCTGGAGCTCCCAGG - Intergenic
1152845971 17:82599991-82600013 CAGCTGCTTTGGGGCCTCCCAGG + Intronic
1155284298 18:24272175-24272197 CAGCAGCTCTAGGACCTCGCAGG - Intronic
1155499393 18:26471881-26471903 CAGCAGCTCTCTGGACTCCTTGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157557576 18:48622769-48622791 AGTCAGCTCTAGGGGCTTCCAGG - Intronic
1160682704 19:419138-419160 CAGGCACCCTAGGGGCTCCCCGG - Intronic
1160702171 19:512909-512931 CAGCGGCTGCAGGTGCTCCCTGG - Intronic
1160748233 19:721217-721239 CTCCAGCTCTAGAGGCTCCCTGG - Intronic
1161390558 19:4018383-4018405 CAGCATCTCGTGAGGCTCCCTGG + Intronic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1161666819 19:5582160-5582182 AAGCGGCTCTTGGTGCTCCCGGG + Intergenic
1161956304 19:7497463-7497485 CAGCACCTCTAGGGGCAGCCGGG - Intronic
1162555398 19:11383195-11383217 CAGAAGCTCTTCGGGCCCCCGGG + Exonic
1162889055 19:13718937-13718959 GAGCAGCTCTAAGCGCTCTCTGG + Intergenic
1163475120 19:17521317-17521339 CAGCAGGCCTGGGGGCGCCCTGG + Intergenic
1164627141 19:29737294-29737316 CAGCAGCTCTCGAGGCCCCGGGG - Intergenic
1165509553 19:36258058-36258080 CAGCAGCTTCAGGGGCTGCCTGG + Intergenic
1165511081 19:36267020-36267042 CGGCAGCTTCAGGGGCTGCCTGG + Intergenic
1165631203 19:37303980-37304002 CGGCAGCTTCAGGGGCTGCCTGG - Intergenic
1165707612 19:37987662-37987684 CAGCTGGCCTAGGGGGTCCCAGG - Intronic
1165717337 19:38054918-38054940 CACCAGCAGCAGGGGCTCCCGGG - Intronic
1166503666 19:43358588-43358610 CAGCTCCTCTAGGGGCAGCCAGG - Intronic
1166506788 19:43376170-43376192 CAGCTCCTCTAGGGGCAGCCAGG + Intergenic
1166762600 19:45234420-45234442 CAGCGGCTCCCGGGGCGCCCGGG - Intronic
1167036124 19:46995944-46995966 GAGCAGCACTAGGAGCTCGCTGG - Intronic
1167281816 19:48573598-48573620 CAGCAGCTCCAGGGGCCCAGAGG + Intronic
1167660172 19:50791737-50791759 CAGCGGGCCTCGGGGCTCCCTGG - Exonic
1168116157 19:54222285-54222307 CACCAGCTCCAGGGGGTCGCTGG + Exonic
1168119140 19:54242033-54242055 CACCAGCTCCAGGGGGTCGCTGG + Exonic
1168121924 19:54256496-54256518 CACCAGCTCCAGGGGGTCACTGG + Exonic
1168125038 19:54278267-54278289 CACGAGCTCCAGGGGCTCACTGG + Exonic
1168129974 19:54311871-54311893 CACCAGCTCCAGGGGGTCGCTGG + Exonic
1168133642 19:54336848-54336870 CACGAGCTCCAGGGGCTCACTGG + Exonic
1168134010 19:54338403-54338425 CACCAGCTCCAGGGGGTCGCTGG + Exonic
1168171877 19:54594923-54594945 CACCAGCTCCAGGGGGTCACTGG - Exonic
1168181197 19:54664009-54664031 CACCAGCTCCAGGGGGTCACTGG - Exonic
1168185406 19:54697035-54697057 CACCAGCTCCAGGGGGTCACTGG - Intronic
925119064 2:1403408-1403430 CAGCAGCTCTGGGCTCTCCGTGG + Intronic
925467842 2:4125618-4125640 CAGCAGCTCTAGGGGAACCAAGG - Intergenic
926150356 2:10422500-10422522 CAGCAGCACTGGGGTCTCCATGG - Intronic
926239049 2:11070845-11070867 CCCCAGCTCTAGGGGTTCCAGGG - Intergenic
927230817 2:20822831-20822853 CTGCAACTCAAGGGACTCCCAGG + Intronic
927463606 2:23320909-23320931 CAGCAGCTTTGGGGGCTCAAGGG - Intergenic
927996659 2:27491935-27491957 TAGCAGCTGAAGGGGCTGCCAGG + Exonic
928003590 2:27542978-27543000 CAGCTACTCCAGAGGCTCCCAGG + Intronic
928321005 2:30282853-30282875 CAGCAGCTCAGGCAGCTCCCAGG + Intronic
928607348 2:32954870-32954892 CAGCAGCTCTGGCTGCTCCAGGG + Intronic
930732435 2:54741152-54741174 CAGCTGCACTTGGGGCTCTCTGG - Intronic
932743745 2:74313892-74313914 CAGCTGCCCTAGGTGCTCCCTGG + Intronic
933760528 2:85668906-85668928 CTGCAGCTGCAGGGGCTCTCAGG + Intergenic
934646722 2:96063311-96063333 AAGCAGCTCCAGAGCCTCCCTGG + Intergenic
934840125 2:97619393-97619415 AAGCAGCTCCAGAGCCTCCCTGG + Intergenic
935725987 2:106024504-106024526 TAGCAGCTCAAGGAGTTCCCTGG + Intergenic
935742649 2:106164178-106164200 CAGCAACTCAAGGGCTTCCCAGG + Intronic
937098258 2:119249544-119249566 CAGGAGCTGCAGGGGCTGCCAGG - Intronic
937438054 2:121895618-121895640 CATCAGCTCCAGGGGCTCTCAGG + Intergenic
941636068 2:167936042-167936064 CAGCAGCTCTGCTGACTCCCAGG + Intergenic
947039068 2:225894557-225894579 GAGCAGCTCCGGGGGCTCCAGGG + Intergenic
947214398 2:227736750-227736772 CATCAGCTCTCAGGGGTCCCAGG - Intergenic
948231111 2:236350325-236350347 CAGCAGCTTTGGGGGCACACAGG + Intronic
948289784 2:236816500-236816522 CAGCAGCGCCAGGGTCTCCTAGG - Intergenic
948894359 2:240921413-240921435 CCACAGCTGTAGGGGCTCCCAGG - Intronic
948956698 2:241298415-241298437 CAGGAGCTTGAGGGGCTCTCAGG + Intronic
1169122863 20:3107749-3107771 CTGCCACTCCAGGGGCTCCCAGG + Exonic
1171009448 20:21500591-21500613 CAGCAGCACCAGCGTCTCCCTGG + Intergenic
1171150395 20:22822334-22822356 CAGCAGCACTGAAGGCTCCCAGG + Intergenic
1171227369 20:23452776-23452798 CAGGAGCTGTAGGGCCTGCCAGG + Exonic
1171414571 20:24968981-24969003 CAGCAGCTCTGGGGGGTACTGGG - Exonic
1171544865 20:25992081-25992103 CGGCAGCTTCAGGGGCTGCCTGG + Intergenic
1172518486 20:35552361-35552383 ATGCAGCCCTAGGGCCTCCCTGG + Intronic
1172973123 20:38888000-38888022 CAGCAACTCCAGGGGGTGCCAGG - Intronic
1173375508 20:42478833-42478855 GAGGAGATCTAGGGGCTCACAGG - Intronic
1174126394 20:48310073-48310095 CAGCAGCTACTGGGGCTCCTGGG + Intergenic
1174280109 20:49433142-49433164 CTGCTGCCCTAGGGGCTCCTGGG - Intronic
1175348608 20:58301537-58301559 GAGCAGCTCTAGTCACTCCCTGG + Intergenic
1176062302 20:63177781-63177803 CAGCAGCGCGCGGGGCCCCCGGG + Intergenic
1176618688 21:9041190-9041212 TAGCAGCCCAAGGCGCTCCCTGG + Intergenic
1176705713 21:10119112-10119134 CGGCAGCTTCAGGGGCTGCCTGG - Intergenic
1177727079 21:24983678-24983700 CAGCAGTTGTAGAGGCTCCTGGG + Intergenic
1177802001 21:25836987-25837009 CAGCAGTTCTTGGTGCTCCTTGG + Intergenic
1178081821 21:29073819-29073841 CAGAAACCCGAGGGGCTCCCTGG - Intergenic
1179474156 21:41632757-41632779 CAGAAGCTCTGGGTGCTCCCTGG + Intergenic
1179567086 21:42256000-42256022 CTACTGCTCTAGGGGCTCCCTGG - Intronic
1179628472 21:42661987-42662009 CAGCAGCTGTGTGGCCTCCCTGG + Intronic
1179642349 21:42756051-42756073 CAGCTGCTCTCGGGGCTGGCAGG + Intronic
1180092085 21:45538444-45538466 CTGCTGCTCTAGCGGCACCCAGG + Intronic
1181489235 22:23251317-23251339 CCGAAGCTATAGGGGCTTCCTGG - Intronic
1181532568 22:23525257-23525279 TGGCAGCTCTAGGTGCTCCTTGG - Intergenic
1181830813 22:25558913-25558935 CAGCTTCTCTGGTGGCTCCCTGG + Intergenic
1183423719 22:37726294-37726316 GGGCAGCTCTGGGGGCTCCCGGG + Exonic
1183632692 22:39042873-39042895 CATCAGCCCTGAGGGCTCCCGGG + Intronic
1184321465 22:43744986-43745008 CAGCAGATCTGGTGGCTCTCTGG - Intronic
1184359196 22:44003973-44003995 AAACAGAACTAGGGGCTCCCTGG - Intronic
1184382871 22:44157128-44157150 TAGCAGCTCCAGAGGCCCCCTGG + Intronic
1184663610 22:45976560-45976582 CTGCAGCTCTCTGGGCTCCGGGG - Intronic
1184759548 22:46536976-46536998 CAGCAGCTCCCGCGGCGCCCGGG + Exonic
1185005988 22:48277273-48277295 CAGCAGCTCAGGGCCCTCCCAGG + Intergenic
1185066840 22:48636703-48636725 CAGCAGCCCTGGGGGCTCCTGGG - Intronic
1185347658 22:50317487-50317509 CAGCAGCTCCAGGAGCCTCCTGG - Intronic
950635107 3:14308678-14308700 CAGCTGCTCCAGGGGCTCCTGGG - Intergenic
953603519 3:44390974-44390996 CAGCAGCTCTTCAGCCTCCCAGG + Intronic
954196375 3:48999455-48999477 CAGCAGGGTCAGGGGCTCCCTGG - Intronic
954376006 3:50194428-50194450 CACCTGCTCTCTGGGCTCCCGGG - Intronic
954407626 3:50354268-50354290 CTACAGCTCTAGGGCCTGCCAGG - Intronic
954690535 3:52393227-52393249 CAGCAGCCGTAGGGGCAGCCTGG - Intronic
955385124 3:58473183-58473205 CAGCAGCTATGGTGGCTGCCAGG + Intergenic
957051924 3:75417992-75418014 CTGCAGGTCTCGGGGCTCCTGGG + Intergenic
958692102 3:97481530-97481552 CGGCGGCTCTAGGGACCCCCGGG - Intronic
960534689 3:118802964-118802986 CTTCAGCCCTTGGGGCTCCCAGG - Intergenic
961013158 3:123448990-123449012 CAGCTGCTCTCGGGGCTCGGCGG + Exonic
961336059 3:126180396-126180418 CTGCAGCTCCGGGGGCTCCGGGG - Intronic
961463863 3:127069920-127069942 CAGCAGCTCCTGGAGCCCCCTGG - Intergenic
961558844 3:127714984-127715006 CAGCAGCGCCAGGGGCTCCAGGG + Intronic
962088044 3:132212496-132212518 TAGCAGCCCTAGGGTCACCCAGG - Intronic
962779154 3:138694848-138694870 CAGAAGCTCTAGGGCCTCCCGGG + Exonic
964587081 3:158318177-158318199 GAGCATATCCAGGGGCTCCCAGG + Intronic
967148035 3:186622551-186622573 CAGTTGCTCTAGGGGCATCCTGG + Intergenic
968222311 3:196948111-196948133 GAGCAGCACCAGGGCCTCCCGGG + Exonic
968698591 4:2044225-2044247 CAGCTGCTCTGGGGGCTCAGGGG - Intergenic
968705048 4:2073800-2073822 CAGCAGAGCGAGGGTCTCCCTGG + Intronic
969256987 4:6008890-6008912 CAGCTGCTCCAGAGCCTCCCAGG + Intergenic
969751245 4:9112923-9112945 CAGCAGCTGTAGGGTGTCCTGGG + Intergenic
969819237 4:9707906-9707928 CTGCAGGTCTTGGGGCTCCTGGG - Intergenic
969846955 4:9926907-9926929 CAGCAGTCCTTGGTGCTCCCTGG - Intronic
971298814 4:25425040-25425062 TGGCAGCTCCAGAGGCTCCCAGG - Intergenic
974479323 4:62423247-62423269 CATCACCTCTAGGGGCCTCCTGG + Intergenic
976168110 4:82276240-82276262 CACCAGCCCTAGGGCCTCCTTGG + Intergenic
977481032 4:97575878-97575900 CATCAGTTCTAGGGGCTCTTTGG - Intronic
978033732 4:103969672-103969694 CAGCAGTTCTATGGGCACCCTGG - Intergenic
980355743 4:131730425-131730447 CAGCAGCTTCAGGGGCAGCCTGG + Intergenic
982358003 4:154490609-154490631 CACCAGATCTAGAGGCTCCAGGG + Intronic
985651172 5:1108456-1108478 CAGCTGCTGCAGGGGCTCCCGGG + Intronic
985797598 5:1974827-1974849 AAGCAGCTTAATGGGCTCCCCGG + Intergenic
985888444 5:2697956-2697978 CAGCAGCTCGAGGGGCCACAGGG + Intergenic
986667556 5:10116678-10116700 CAGCAGTGCTGGGGGCTCCTTGG - Intergenic
986778885 5:11046016-11046038 CAGCAGCTGTTGGGGCTACTTGG + Intronic
986887717 5:12260517-12260539 GAGCAGCTCTATGGGCTGCTTGG + Intergenic
987002690 5:13676216-13676238 CAGCAGCTCTAGTAAATCCCAGG - Intergenic
987451772 5:18093804-18093826 CAGCTGCTCTTGGGTCTGCCTGG + Intergenic
989711459 5:44402279-44402301 CATCAGCTCTATGAGCTCTCAGG + Intergenic
991585293 5:68196013-68196035 CAGCACCTCTATGGGATCACTGG - Intronic
991728452 5:69560170-69560192 CCGCCGCTTTAGGGGCGCCCCGG - Intergenic
991804881 5:70415317-70415339 CCGCCGCTTTAGGGGCGCCCCGG - Intergenic
991866503 5:71067705-71067727 CCGCCGCTTTAGGGGCGCCCCGG + Intergenic
997815314 5:137011371-137011393 CGGCATCTCTAAGGACTCCCAGG + Intronic
998879730 5:146633759-146633781 AAGCAGCTTCTGGGGCTCCCTGG + Intronic
999068107 5:148713967-148713989 CAGCAGCTCCAGAGACTCCAAGG + Intergenic
999448724 5:151662772-151662794 CAGGGGCTCTAGGGACTGCCAGG - Exonic
1001109498 5:168883871-168883893 AAGAAGGTCTAGGGGCCCCCAGG - Intronic
1002640805 5:180629783-180629805 CAGCAGCTCCAGCGACTTCCTGG + Exonic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1003270810 6:4606334-4606356 CACCAGCTCTAGGGACTGCAGGG + Intergenic
1003410314 6:5856182-5856204 CAGCAGCTCTGGTGGCCCTCAGG - Intergenic
1004170465 6:13291873-13291895 CTGCTGCTCCAGGGGCCCCCTGG - Intronic
1006409417 6:33863635-33863657 CAGCAGCTGTGGGTGCTCCGAGG - Intergenic
1008079667 6:47180753-47180775 CCTCACCTCTAGGGGCCCCCTGG + Intergenic
1015043801 6:128754991-128755013 CAGCATTTCTAGGGGCTCTGTGG + Intergenic
1016409398 6:143765959-143765981 CAGCAGCCCTAGGCATTCCCAGG - Intronic
1016948986 6:149562177-149562199 CAGGAGCTAGAGGGGCTCCAGGG - Intergenic
1017916056 6:158832359-158832381 CAGCACCTCTGCTGGCTCCCAGG + Intergenic
1018058584 6:160072323-160072345 CAGCAGCTCTAGGCTCTCCAGGG + Intronic
1018430133 6:163715696-163715718 CAGCAGCTCCAGTGGCTTCCAGG + Intergenic
1018928027 6:168220433-168220455 CTGAAGCTCCTGGGGCTCCCTGG + Intergenic
1018948550 6:168364000-168364022 CATCAGCTCTGTGGGGTCCCAGG - Intergenic
1019427567 7:984647-984669 CAGCAGCGGGAGAGGCTCCCAGG + Intronic
1019639899 7:2097719-2097741 CAGCAGCAGCAGGGGCTGCCCGG + Intronic
1019648812 7:2145163-2145185 CAGCAGCTCTCGGCAGTCCCCGG - Intronic
1019879360 7:3844773-3844795 CAGCAGCACGAGAGGCTCACAGG - Intronic
1022954255 7:35366804-35366826 CAGGGGCTCTAGGAGCCCCCTGG - Intergenic
1025296263 7:57777144-57777166 CAGCAGCTTCAGGGGCTGCCTGG + Intergenic
1026010148 7:66629532-66629554 CATCAGCTCTCGGGGCTCCAGGG - Intronic
1026953801 7:74364397-74364419 CAGCACCTCTAGGCCCCCCCGGG + Intronic
1027268203 7:76505366-76505388 CAGGAGCTCTAGGACCTGCCCGG - Exonic
1032055342 7:128680062-128680084 CAGCAGCACGAGGGGCTCGCTGG - Exonic
1032496722 7:132368418-132368440 CAGCAGCTCCTGGGCCTGCCAGG + Intronic
1033214398 7:139483268-139483290 CTGCAGCTCCATGGGCGCCCAGG + Exonic
1034996160 7:155578373-155578395 CAGCAGCCCTCAGGGCTCTCAGG + Intergenic
1035888238 8:3316546-3316568 GAGCAGGTCTAGGGGCCTCCTGG + Intronic
1036223647 8:6940869-6940891 CAGCAGCTCTCTGGGATGCCAGG + Intergenic
1036381418 8:8238457-8238479 CTGCAGGTCTCGGGGCTCCTGGG - Intergenic
1036651712 8:10648416-10648438 GAGCAGCTCTAGGGGGACGCTGG - Intronic
1036788776 8:11704251-11704273 CTGCAGCTCCGGGGGCTCCCAGG + Exonic
1036847242 8:12178535-12178557 CTGCAGGTCTCGGGGCTCCTGGG + Intergenic
1036868609 8:12420856-12420878 CTGCAGGTCTCGGGGCTCCTGGG + Intergenic
1040325038 8:46337384-46337406 GAGCAGTTCTGGGGGCTCCTGGG - Intergenic
1040342391 8:46447525-46447547 GAACAGCCCTAGGGGCTCCCAGG + Intergenic
1040440661 8:47438220-47438242 CAGCAGCTGTCAGGGCTCCATGG - Intronic
1041332879 8:56747481-56747503 CAGCAGCTCTAGTCACTCCCTGG + Intergenic
1043926446 8:86042242-86042264 CAGCAGCCCTTGGCGCTCCATGG - Intronic
1044611645 8:94097898-94097920 AAGCACCGCTGGGGGCTCCCAGG - Intergenic
1045384883 8:101662582-101662604 CAGCAGCTGGTGGGGCTCACAGG - Intronic
1045469229 8:102496583-102496605 CAGCATTTCCAGGGGCTGCCGGG + Intergenic
1045648773 8:104324141-104324163 CCGCAGCCCTGTGGGCTCCCTGG + Intergenic
1046198758 8:110894310-110894332 CTTCAGCCCTTGGGGCTCCCGGG - Intergenic
1046659923 8:116938286-116938308 CAGGGGCTCCAGGGACTCCCAGG + Exonic
1049399487 8:142418593-142418615 CAGGAGCTTCAGGGGCTGCCTGG - Intergenic
1049440776 8:142608597-142608619 AAGAACCTCTAGGGGCTTCCTGG + Intergenic
1049539819 8:143203246-143203268 CAGCAGCTTTCGGCTCTCCCAGG - Intergenic
1049571134 8:143370793-143370815 CAGGGGCTGCAGGGGCTCCCGGG + Intronic
1049591609 8:143465335-143465357 CTGCAGCCCTGCGGGCTCCCTGG + Intronic
1051604468 9:18906693-18906715 CAGCAGTTCTGGGTGCTCACAGG - Exonic
1052975156 9:34404833-34404855 AAACAGCTCGAGGGGCTCCCTGG + Intronic
1053446757 9:38158840-38158862 CTGAGGCTCTTGGGGCTCCCAGG - Intergenic
1053586469 9:39464242-39464264 CCGCAGGTGTAGGGGCTGCCGGG - Intergenic
1053642996 9:40106229-40106251 CGGCAGCTTCAGGGGCTGCCTGG - Intergenic
1053763153 9:41359259-41359281 CGGCAGCTTCAGGGGCTGCCTGG + Intergenic
1054257828 9:62833464-62833486 CAGTGGCTCTAGAGGCCCCCTGG - Intergenic
1054323845 9:63703456-63703478 CGGCAGCTTCAGGGGCTGCCTGG - Intergenic
1054541764 9:66270374-66270396 CGGCAGCTTCAGGGGCTGCCTGG + Intergenic
1054579837 9:66900991-66901013 CCGCAGGTGTAGGGGCTGCCGGG + Intronic
1055558079 9:77495976-77495998 AAGCAAGTCTAGGGCCTCCCTGG - Intronic
1055646923 9:78369872-78369894 CGGCATCTCTAGGAGTTCCCAGG - Intergenic
1059434511 9:114267940-114267962 CATCAGCTCTGGGGCCTCCAAGG - Intronic
1060755350 9:126208465-126208487 CAGGAGCTCTTGGGGCTTCAGGG - Intergenic
1061038049 9:128124394-128124416 CAGCAGCTCCACGTGCTCCCAGG + Intronic
1061247943 9:129410834-129410856 TGGCAGCTCTAGGTGCTCCTTGG + Intergenic
1061885223 9:133587894-133587916 TATCTGCTCCAGGGGCTCCCAGG - Intergenic
1062110932 9:134781790-134781812 CGCCAGCTCCCGGGGCTCCCAGG - Intronic
1062192043 9:135253122-135253144 CTCCAGCTCCAGGAGCTCCCAGG - Intergenic
1062610147 9:137369893-137369915 CAGAAGCTCTCTGGGCACCCGGG + Intronic
1202790747 9_KI270719v1_random:89201-89223 CGGCAGCTTCAGGGGCTGCCTGG - Intergenic
1186681803 X:11882798-11882820 GAGCATATTTAGGGGCTCCCAGG + Intergenic
1187297028 X:18012032-18012054 CAGCAGCTACAGCGGCTCCCTGG + Intergenic
1189165770 X:38859389-38859411 TAGCAGTTCTAGGAGGTCCCAGG - Intergenic
1189328078 X:40125201-40125223 CAGCAGCTCCAGCAGCTGCCTGG + Intronic
1192174894 X:68879374-68879396 CATTAGCTCGAGGGGCGCCCTGG + Intergenic
1192737338 X:73861884-73861906 CAGCAGCTCCAGGGGCTGTTTGG + Intergenic
1193252164 X:79304019-79304041 GATCAGTTCTAGGGGCCCCCTGG - Intergenic
1194833632 X:98656394-98656416 CCTCACCTCTAGGGGCCCCCAGG - Intergenic
1195884317 X:109624189-109624211 CAGCTGCTCCAGGGGCTGCCAGG - Exonic
1195964622 X:110418778-110418800 CAGCAGCTGGAGGAGCTGCCAGG - Intronic
1197560215 X:128011609-128011631 CCTCAGCTCTGGTGGCTCCCAGG - Intergenic
1197591548 X:128416939-128416961 CCTCACCTCTAGGGGCTCACTGG - Intergenic
1199747776 X:150784887-150784909 CAGAAGCTCTAGGAGAGCCCAGG + Intronic
1200703109 Y:6419004-6419026 CAGCAGCTCTAGAGGCTGTGTGG + Intergenic
1200839531 Y:7766549-7766571 CTGCAACTCTAAGAGCTCCCAGG + Intergenic
1201031001 Y:9745703-9745725 CAGCAGCTCTAGAGGCTGTGTGG - Intergenic
1202181477 Y:22143466-22143488 CAACAGATCTATGGGCTGCCAGG - Intergenic
1202209883 Y:22442934-22442956 CAACAGATCTATGGGCTGCCAGG + Intergenic