ID: 1090206543

View in Genome Browser
Species Human (GRCh38)
Location 11:124887443-124887465
Sequence AGCTGAGGAGTTTCGGTCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090206540_1090206543 -8 Left 1090206540 11:124887428-124887450 CCAGCTCATTTGAGGAGCTGAGG 0: 1
1: 0
2: 1
3: 33
4: 324
Right 1090206543 11:124887443-124887465 AGCTGAGGAGTTTCGGTCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090206543 Original CRISPR AGCTGAGGAGTTTCGGTCCC AGG Exonic
900321849 1:2088384-2088406 AGCTGAGGGATTTGGTTCCCAGG - Intronic
901164336 1:7207061-7207083 AGCTGAGAAGTGTCTGGCCCTGG + Intronic
904279816 1:29411068-29411090 AGCTGAGGAAATTCAGGCCCAGG + Intergenic
904420858 1:30390308-30390330 AGCTCAGGAGTCACTGTCCCAGG - Intergenic
904662092 1:32093050-32093072 AGCTGAGGAGGTACCTTCCCAGG - Intronic
912203243 1:107481954-107481976 AGCTGACGAATTTAGTTCCCAGG + Exonic
916497916 1:165361845-165361867 AACTGAGGGGTTTCTGTGCCTGG + Intergenic
917068168 1:171120523-171120545 AGAAGAGGAGATTCGGTCACAGG - Intergenic
918130988 1:181629219-181629241 TGTTGAGGAGTTTCAGTCTCAGG + Intronic
920806722 1:209241588-209241610 AGCTGAGGAGTGTCCTTCCCTGG + Intergenic
1069445669 10:68471514-68471536 AGTTGAGGAGTTTCGGCCACTGG - Intronic
1069994201 10:72332580-72332602 ACCTGAGCAGTCTGGGTCCCTGG - Intergenic
1070435210 10:76384620-76384642 AGTTCAGGACTTTCCGTCCCAGG + Intronic
1072626652 10:97116555-97116577 AGCAGTGGGGTTTCTGTCCCTGG + Intronic
1073592398 10:104769503-104769525 TGCTGAGGAGCTTGGGACCCAGG + Intronic
1074858476 10:117491161-117491183 AGCTAAGGAGTTAGGGTCCCTGG + Intergenic
1075222596 10:120598263-120598285 ATCTGAGGGGTTCTGGTCCCAGG - Exonic
1075441971 10:122487182-122487204 AGCAGAGGAGTGCGGGTCCCTGG + Intronic
1080898878 11:36468436-36468458 AGCTGAGCAGATTCTGCCCCTGG - Intergenic
1084953881 11:72681156-72681178 AGCTGAGGAGATTCGGGACCTGG + Intergenic
1090206543 11:124887443-124887465 AGCTGAGGAGTTTCGGTCCCAGG + Exonic
1091260832 11:134232900-134232922 AGCCGAGGAGTCCCTGTCCCCGG + Intronic
1092086306 12:5765297-5765319 AGCTGAGTAGTTACTGTTCCCGG - Intronic
1093161178 12:15748545-15748567 AGCTGTGGAATTTCTCTCCCTGG - Intronic
1094552904 12:31469686-31469708 AGGTGAGGTGTTTGGGTCCTGGG + Intronic
1095476189 12:42589540-42589562 GGCTGAGGAGCTGCGGTCCGCGG + Exonic
1095909708 12:47413952-47413974 AGCAGAGGGGTTTAGGGCCCTGG + Intergenic
1096483090 12:51956114-51956136 AGCTGTGAAGTTTCCATCCCAGG + Intronic
1105215651 13:18283080-18283102 AGCTGGAGAGTTTCCTTCCCAGG + Intergenic
1112333696 13:98497080-98497102 AGCTGAGGGGTGCCTGTCCCTGG - Intronic
1112448584 13:99489433-99489455 AGCTGAAGAATTTCAGGCCCAGG + Intergenic
1113311687 13:109139469-109139491 GGCTGCGGAGGTGCGGTCCCTGG - Intronic
1115909358 14:38238450-38238472 AGCTCAGGAGTTTGAGACCCTGG - Intergenic
1118730788 14:68664891-68664913 AGAAGAGGAGTTTCTCTCCCTGG - Intronic
1120169754 14:81236451-81236473 GGCTGAGGAGTGTGGGTGCCTGG + Intergenic
1121950891 14:98170514-98170536 TGCTGAGGAGTCTCTGCCCCAGG - Intergenic
1129383521 15:75183009-75183031 AGCTAAGGACCTTGGGTCCCAGG + Intergenic
1132058356 15:98669721-98669743 AGCTGAGGTGTGTCTGCCCCAGG + Intronic
1132997114 16:2829168-2829190 CCCTGAGGAGCTTCAGTCCCTGG + Intergenic
1134808788 16:17149055-17149077 AGCTGAGTAGATTTGGTCCCTGG - Intronic
1139670942 16:68492305-68492327 GGCTGAAGCGTTGCGGTCCCTGG - Intergenic
1141444092 16:84047088-84047110 ATCCGAGGACTTTTGGTCCCTGG - Intergenic
1143263567 17:5618892-5618914 AGGGGAGGACTTTGGGTCCCTGG + Intronic
1148567667 17:48643027-48643049 AGCCCAGGAGCTCCGGTCCCTGG + Intergenic
1149605437 17:57921624-57921646 GGCTGGGGAGCTTCTGTCCCAGG + Intronic
1158198869 18:54918174-54918196 AGCTGAGGGCTTTCAGCCCCAGG - Intronic
1159766424 18:72495349-72495371 AGCAGAGGGTTTTCTGTCCCAGG + Intergenic
1162842400 19:13365903-13365925 GGCTGAGGAGTTTGAGTCCTTGG - Intronic
928198780 2:29233474-29233496 ATCTGAGGTGTTTCTATCCCAGG + Intronic
934298679 2:91763645-91763667 AGCTGGAGAGTTTCCTTCCCAGG - Intergenic
937626585 2:124050687-124050709 AGCTGAGCAGTTTGGGCACCTGG + Intronic
939121760 2:138125665-138125687 AGCTGAGCAAATTCTGTCCCTGG - Intergenic
948401574 2:237689505-237689527 AGCTGATGAGTCTTAGTCCCAGG - Intronic
1171210916 20:23316265-23316287 AGCTGAGTAGTGTCATTCCCTGG - Intergenic
1177559998 21:22738478-22738500 ACCTGAGAGGTTTCTGTCCCAGG + Intergenic
1178020990 21:28408098-28408120 AGCTGAGGAATTCCAGTCACAGG - Intergenic
1178487098 21:33026065-33026087 AGTTGAGGAGAGTCTGTCCCTGG - Exonic
1182295994 22:29311506-29311528 GGCTGAGGAGTCACTGTCCCCGG - Intronic
1183257638 22:36772902-36772924 GGCTGAGGTCTTTTGGTCCCTGG + Intronic
1184440107 22:44505962-44505984 ATGTGAGGTGTTTGGGTCCCCGG + Intergenic
1184745762 22:46454810-46454832 AGCTAAGGAGTTTGGGAACCAGG - Intronic
1184781681 22:46652712-46652734 AGCTGCAGATTTTCGGTGCCTGG + Intronic
953160281 3:40413080-40413102 AGATGAGGATTTTAGGTCCATGG - Intronic
954692746 3:52404327-52404349 ACCTGCGGAGTTTGGGGCCCTGG - Intronic
982070732 4:151692320-151692342 AGGTGCTCAGTTTCGGTCCCAGG - Intronic
982138260 4:152293500-152293522 AGCTGAGGAGCCCCTGTCCCAGG + Intergenic
982307951 4:153953423-153953445 AGCTGAGGAGTTTGTGTATCAGG + Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
988577638 5:32443459-32443481 AGCTATGGAGTTTAGGCCCCAGG - Intronic
988846125 5:35130053-35130075 AGTTGAGGATATTCGGTGCCAGG - Intronic
992753897 5:79886389-79886411 AGCTGTGGAGTTGCTGTGCCTGG - Intergenic
995697746 5:114899322-114899344 AGCAGAGGAGTTTCTTTCCATGG + Intergenic
997850927 5:137332034-137332056 TGCTGAGGAGTTTCTATCACTGG - Intronic
999167656 5:149564481-149564503 AGATGAGCAGTTTCCTTCCCAGG - Intronic
1005890575 6:30134709-30134731 AGCACAGGAGCTTCTGTCCCCGG + Intergenic
1006348525 6:33503026-33503048 AGCTGAGGAGTGTGGGTGCACGG + Intergenic
1006978683 6:38127815-38127837 TGCTGAAGAGTTTCTGTCCAGGG + Intronic
1007998757 6:46336634-46336656 AGCTGAGGACTTTGAGTGCCAGG + Intronic
1012666389 6:101976362-101976384 AGCTGAGGAATTTAGGTTACTGG + Intronic
1016936433 6:149451743-149451765 TGCAGAGGAGTGTCGTTCCCAGG + Intronic
1018122315 6:160647286-160647308 AGCTGAGGAGTTTGGGCTGCGGG + Intronic
1019354482 7:571619-571641 AGCTGGGGAATTTCGGTCTCGGG + Intronic
1023103924 7:36745846-36745868 AACTGTGGAGTTTGGGACCCTGG + Intergenic
1023327571 7:39076363-39076385 AGCTGAGATGTTTGAGTCCCTGG - Intronic
1024050957 7:45623152-45623174 AGCTGACAAGTTTCAATCCCAGG - Intronic
1035133376 7:156676046-156676068 AGCCTAGGAGTGTCAGTCCCGGG + Intronic
1039389702 8:37168246-37168268 ATCTGGTGAGTTTCAGTCCCTGG + Intergenic
1049654394 8:143791407-143791429 TGCTGAGGAGTTGAGGTCCCTGG - Exonic
1051059957 9:13034407-13034429 AGCTGAGCAGTGTGGATCCCTGG + Intergenic
1054968566 9:71058364-71058386 AGCTGTGCAGTCTCCGTCCCTGG - Intronic
1057669718 9:97077090-97077112 AGCTGAGGAGTCACTGTCCTCGG + Intergenic
1058833247 9:108837984-108838006 AGTTGAGGAGTTTTTGTCTCTGG - Intergenic
1062394242 9:136346325-136346347 AGCTGAGGACTTGGGGGCCCAGG - Intronic
1190980714 X:55454832-55454854 AGCTGAGGAGAGTGGGTCCCTGG - Intergenic
1190987983 X:55518348-55518370 AGCTGAGGAGAGTGGGTCCCTGG + Intergenic
1200590273 Y:5064927-5064949 AGGTGAGGAGTTTGAGACCCTGG - Intronic