ID: 1090206983

View in Genome Browser
Species Human (GRCh38)
Location 11:124890777-124890799
Sequence CTCACTTCTCAGAGAGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090206983_1090206991 20 Left 1090206983 11:124890777-124890799 CCCATTCCTCTCTGAGAAGTGAG 0: 1
1: 0
2: 1
3: 26
4: 213
Right 1090206991 11:124890820-124890842 ACACCTGTACATAGTACACCAGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090206983 Original CRISPR CTCACTTCTCAGAGAGGAAT GGG (reversed) Intronic
903137167 1:21317250-21317272 CCCACTTCACAGAGAAGACTAGG - Intronic
903386888 1:22932931-22932953 CTCACTTCTCTGAGCAAAATGGG + Intergenic
903678294 1:25080369-25080391 TTCACTTGTCAGGGAGGAAGAGG - Intergenic
903795902 1:25928747-25928769 CTCACTTCACAGAGTGGGATAGG - Intergenic
904040806 1:27583761-27583783 CTTATTTCACAGATAGGAATCGG - Intronic
904809070 1:33151530-33151552 CTGACTTCTCAGAGGGGGAAGGG - Intronic
904941823 1:34169117-34169139 CTAACTTCTCTGTGAGGAAAGGG + Intronic
906669666 1:47645346-47645368 CTCTCTTCCCAGAAAGGAAAGGG + Intergenic
908377356 1:63557298-63557320 CTCATTTCTTAGAGATGAAAAGG - Intronic
912221076 1:107676206-107676228 CTCACTTCTCAGGTGGGAAGTGG - Intronic
912953635 1:114137400-114137422 CTCACTTCCTAGAGACAAATGGG - Intronic
913956023 1:143294449-143294471 CTCACTTCCTAAAGAGTAATTGG + Intergenic
914947354 1:152079185-152079207 CTCACTTCCCAGAGTGTAAGGGG + Intergenic
915454744 1:156032661-156032683 CTCAGTTCTCACAGAGAGATGGG + Intergenic
915798894 1:158767213-158767235 CTGAGTTCTCATAAAGGAATAGG - Intergenic
915841527 1:159217046-159217068 CTGACTTCTCAGGGATGTATGGG + Intergenic
916883945 1:169048776-169048798 CTCCCTTCTTAGAGAGCATTTGG - Intergenic
921441727 1:215195289-215195311 CTCAGTTCTGAGACAGCAATTGG - Intronic
921745578 1:218736907-218736929 CTCACTTCTGAAAGAAGAAAAGG + Intergenic
922558344 1:226549473-226549495 CCCACTTCCCCGAGAGGAATGGG + Intronic
923025039 1:230197269-230197291 CTCACTTCTCACAGCGCTATGGG + Intronic
1067151049 10:43734904-43734926 CTCACTTCACAAAGATGAACTGG - Intergenic
1067239301 10:44476701-44476723 CTCACAGCTCAGAGGGGAGTGGG + Intergenic
1067578358 10:47421846-47421868 CTCTGTTCTCAGATAGGAACAGG + Intergenic
1067804584 10:49384150-49384172 CCCACTTCTGAGAGAGGCCTGGG - Intronic
1069638327 10:69939078-69939100 CTCACTTTTGATAGAGGCATGGG + Intronic
1071956991 10:90770562-90770584 CTCCCATCTCAGAGCGGGATTGG + Intronic
1072531690 10:96325459-96325481 CTCAATGCTTAGAGAGAAATTGG + Intronic
1075414469 10:122252302-122252324 CTCATTTTTCAGTGAGGAAATGG - Intronic
1075791013 10:125084510-125084532 CTCCCTTCCCAGAGAGGATGGGG - Intronic
1077131646 11:975943-975965 CACACTCCTCAGAGAGGAGGAGG - Intronic
1078450077 11:11434223-11434245 CTCTCTCGCCAGAGAGGAATGGG + Intronic
1078954403 11:16174074-16174096 CTCACCTCTCAGACAAAAATGGG + Intronic
1081491546 11:43573212-43573234 TTGACTGCTCAGACAGGAATTGG + Intronic
1081719187 11:45274510-45274532 GTCACTTCACATAGAGGAAAGGG - Intronic
1081805278 11:45886666-45886688 CTCACTTCTCTGAAATGCATCGG - Intronic
1082791394 11:57348687-57348709 CTCACTTCTCAAAGTTGAAGAGG - Exonic
1082947139 11:58772501-58772523 CTGACTTTTCAAAGAGGCATGGG + Intergenic
1086095927 11:83049900-83049922 CTCACTCCTCAAAGTAGAATTGG + Intronic
1090110792 11:123906414-123906436 CAGATTTCTCAGAGAAGAATGGG + Exonic
1090206983 11:124890777-124890799 CTCACTTCTCAGAGAGGAATGGG - Intronic
1090601696 11:128379045-128379067 CTCACATGGCAGAGAGGAAGAGG + Intergenic
1090644855 11:128759012-128759034 CTCCCTTCTCAAACAGGACTGGG + Intronic
1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG + Intergenic
1091647984 12:2288252-2288274 CTCACTCCTCAGAGAGAAGCTGG - Intronic
1093607082 12:21105278-21105300 TCCACTCCTCAGAAAGGAATAGG - Intronic
1096603168 12:52745013-52745035 CTCATTTCTCAGACAGGGATTGG - Intergenic
1098459782 12:70720030-70720052 CGCTCTTCTCAAAGTGGAATTGG + Intronic
1100212337 12:92410446-92410468 CTCACTGCTCAGAGTGACATAGG - Intergenic
1101314420 12:103616194-103616216 TACACTGATCAGAGAGGAATTGG - Intronic
1101905252 12:108819961-108819983 TTCCTGTCTCAGAGAGGAATTGG + Intronic
1102194311 12:111013560-111013582 CTCACTCCTCAGACAGGATAAGG + Intergenic
1105634294 13:22202485-22202507 CTCATTTTACAGAGAGGAAAAGG + Intergenic
1106093499 13:26621108-26621130 CTCCATTCTCAGTGGGGAATGGG - Intronic
1106562283 13:30857116-30857138 CTCACATCTCTGAGAGGGTTTGG + Intergenic
1106909126 13:34444392-34444414 CTAACTTCTTTGAGAAGAATTGG - Intergenic
1107052776 13:36069758-36069780 ATCACTGCTCAGAGAGTAATGGG - Intronic
1110550999 13:76811442-76811464 CTCACATAGCAGAGAGGAAGAGG - Intergenic
1110999094 13:82154973-82154995 CTAACTCCTTTGAGAGGAATCGG - Intergenic
1111019459 13:82428237-82428259 ATCATTTCTCAGAAAGGCATTGG - Intergenic
1111912668 13:94329451-94329473 TTCTCTTCTGAGGGAGGAATTGG - Intronic
1114600638 14:23953451-23953473 CCCACTTCCCAGAGAAGAAAAGG + Intergenic
1116490745 14:45499936-45499958 CACCCTTCCCAGATAGGAATAGG + Intergenic
1116615002 14:47124441-47124463 TTGAGTTCTCAGTGAGGAATAGG + Intronic
1119292096 14:73503461-73503483 CACTTCTCTCAGAGAGGAATGGG + Intronic
1119902880 14:78276283-78276305 CTCACTTCACACTGAGGAATGGG + Intronic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1120518052 14:85493408-85493430 CTCAGTTCTAAGAAGGGAATAGG + Intergenic
1121649138 14:95544132-95544154 CTCTCTGCTCAGCGAGGACTTGG - Exonic
1122508334 14:102246514-102246536 GTCTCTTGCCAGAGAGGAATTGG - Intronic
1123586672 15:21766507-21766529 ATATCTTCTTAGAGAGGAATAGG + Intergenic
1123623311 15:22209072-22209094 ATATCTTCTTAGAGAGGAATAGG + Intergenic
1123879463 15:24662796-24662818 CTCATTTCCCAGAGAGAAATGGG + Intergenic
1124100344 15:26687068-26687090 CTCACTTCCCAGAGTGGCAGGGG - Intronic
1126221216 15:46215805-46215827 CTCATTTCTCAAACAGGATTGGG - Intergenic
1126986233 15:54312822-54312844 CTAACCTGACAGAGAGGAATGGG - Intronic
1127581395 15:60342067-60342089 CCCCCTTCTCAAAGAGGAGTTGG - Intergenic
1127933539 15:63614077-63614099 CTCAGTTCTAAGAGATGAAGAGG + Intronic
1128718856 15:69930839-69930861 CTTACTTCACAGAGAGTCATTGG - Intergenic
1130823143 15:87516251-87516273 CTTCCTTCTCAGGGAGGAAGAGG - Intergenic
1131375328 15:91918342-91918364 CAGACTTATCACAGAGGAATGGG - Intronic
1131382187 15:91973198-91973220 CTCATTTCCCAGAGAAGAAGTGG + Intronic
1131972825 15:97909283-97909305 CTCAACTCTCAGAGATGATTTGG + Intergenic
1132456896 16:29078-29100 CCCACTTCTCAGAGAGGTCAGGG + Intergenic
1132755547 16:1482794-1482816 CTCACTTTTCAGATAGGAAGAGG + Intergenic
1133608139 16:7408406-7408428 GTCACTGCACAGAGATGAATGGG + Intronic
1135210221 16:20519565-20519587 TTCCCTGCTCTGAGAGGAATTGG - Intergenic
1135904655 16:26500153-26500175 GTCACTTATCAGAGAGGAAAGGG + Intergenic
1138829251 16:60358283-60358305 CTCACTTCCCAGAGTGTAAGGGG + Intergenic
1142285649 16:89170532-89170554 CTCCCATCACAGAGAGGAACGGG + Intergenic
1147690349 17:42311174-42311196 CTCCCTTCTGAGAGATGAATCGG - Exonic
1150032562 17:61754780-61754802 CTCTCTATTCAGAGAGGAACAGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150966242 17:69972431-69972453 CTCATCTCTCAGAGAGGAATAGG - Intergenic
1152164356 17:78692569-78692591 CTCTCTTCTCAGAGAGGGTTGGG + Intronic
1153476015 18:5499329-5499351 CCCAGTTCTGAAAGAGGAATAGG - Intronic
1157438083 18:47687994-47688016 CTCACTTCTAACAAAGGAAAGGG + Intergenic
1158252597 18:55506289-55506311 CTCTCTTTGCAGAGAGGATTAGG + Intronic
1158358615 18:56647926-56647948 CTCACATCTGTGAGAGGAAAAGG + Intronic
1158388685 18:57024523-57024545 CCCTATTCTCAGACAGGAATAGG + Intronic
1158388700 18:57024661-57024683 CCCTATTCTCAGACAGGAATAGG + Intronic
1158388708 18:57024730-57024752 CCCTATTCTCAGACAGGAATAGG + Intronic
1158388715 18:57024799-57024821 CCCTATTCTCAGACAGGAATAGG + Intronic
1158590225 18:58772835-58772857 CTCCCTTCTGAGAGAGGAGGTGG - Intergenic
1161065920 19:2237165-2237187 CTCACTGCTCAGGGAGGCCTTGG + Intronic
1162215346 19:9129368-9129390 CTCACTTCTCCGATGGGAACTGG + Intergenic
1162966533 19:14158863-14158885 CTCACAGCTCAGAGAGGATGGGG - Intronic
1163134413 19:15299207-15299229 GTCACTTCTCATAGAGTGATGGG - Intronic
1164383890 19:27757342-27757364 CTCCCTTCTCAGTGGGGTATGGG + Intergenic
1166789366 19:45389315-45389337 ATCACTTCTCAGAGAAGCAGGGG - Intronic
1167393317 19:49211003-49211025 CTCCCTTCTCAGGGTGGACTTGG + Exonic
1167718027 19:51156741-51156763 CTCACTTCTCAGATTAGAAATGG - Intergenic
1168188320 19:54716478-54716500 CTCACTTCTCAGAGTGGTTGTGG - Intergenic
1168270059 19:55245038-55245060 CCCACTTTTAAAAGAGGAATTGG - Intronic
927311976 2:21641702-21641724 CTCATTTCTGAGAGAGGAAATGG + Intergenic
928588847 2:32792537-32792559 CTCAGTTATCAGAGAGAGATAGG - Intronic
928653485 2:33425759-33425781 CAGCCTTCACAGAGAGGAATGGG - Intergenic
929349904 2:40938022-40938044 TCCAATTCTCAGAGAGCAATTGG - Intergenic
932063046 2:68527562-68527584 CTCACTTCCCAGAGTGTAAGGGG + Intronic
932330035 2:70893467-70893489 CTCCCTTCACAGAGTGAAATTGG + Intergenic
932426908 2:71643663-71643685 CCCACTTCACAGAAAGGAAAAGG + Intronic
932824651 2:74928219-74928241 CTCAATTCGGAGAGAGGAAAGGG - Intergenic
935276762 2:101481750-101481772 CTCATTTCACAGGGAGGAAAAGG + Intergenic
935696901 2:105778082-105778104 CTCACTTCACAGAGCTCAATGGG - Intronic
936061971 2:109300772-109300794 CTCACTTCTGAGAAAGGAGGTGG - Intronic
937037246 2:118792428-118792450 ATGACTTGTCAGAGAGGAAGGGG + Intergenic
937876645 2:126831000-126831022 CTGACTCCACAGAGAGGAAGTGG + Intergenic
939067026 2:137495699-137495721 CTCACTGCTCAGAAATGTATGGG - Intronic
941853241 2:170205450-170205472 CTCACATCTCAGGGAGGCACAGG - Intronic
943417422 2:187625859-187625881 CTCATTTTTCAGATAGGAAATGG + Intergenic
945647214 2:212512563-212512585 CATACTTCTCAGAAAGGTATTGG - Intronic
946112652 2:217433680-217433702 TTCTCTTATCAGAGAGGAGTGGG + Intronic
947227752 2:227856728-227856750 CTCACAGCTCAGAGAGGACTTGG + Intergenic
947629631 2:231643681-231643703 CTCACTTCACAGACAGAAATAGG + Intergenic
948182386 2:235992464-235992486 CTGAATCCTCAGAAAGGAATGGG - Intronic
1168763882 20:368718-368740 CTCACTGCTCCAACAGGAATGGG - Intronic
1171322196 20:24256169-24256191 CTCGCTCCTCAGAGATGAATCGG - Intergenic
1172975346 20:38902096-38902118 CACACTTTTAAGACAGGAATGGG + Intronic
1174202812 20:48819072-48819094 CTAAGGTCTCAGAGAGGAATGGG - Intronic
1175494851 20:59406761-59406783 TTCACTTCTCAGCTAGGAAACGG + Intergenic
1178069155 21:28942488-28942510 CTTATTTCTGAGAGAGAAATAGG - Intronic
1178901908 21:36605346-36605368 CTCTGTGCTCAGGGAGGAATAGG + Intergenic
1179657974 21:42857216-42857238 CTCTCTTCTCAGTGAGTATTTGG - Intronic
1183315755 22:37136066-37136088 CTCGCTTTTCAGACAGGAACAGG - Intronic
951041721 3:17995297-17995319 CTGACTTCTCAGACAGCTATGGG + Intronic
955254945 3:57321589-57321611 CTCACTTCTAAGAAAGAAAAGGG - Intronic
955638167 3:61053137-61053159 CTCACTTTTCAGGGTGGATTTGG - Intronic
960577725 3:119243848-119243870 TTCATTTCACAGAGAGGCATTGG + Intergenic
963141089 3:141946648-141946670 ATCACTTCTCAGAGACGTTTTGG + Intergenic
964358658 3:155871590-155871612 CTTCCTTCTCAGAGAGGAAAGGG + Intronic
964733822 3:159895530-159895552 GTCACTTCTCAGAGAATGATGGG - Intronic
965263241 3:166510367-166510389 CTCCCTTCGCTGAGAGGAAGGGG - Intergenic
966258432 3:177946322-177946344 CACACTTCTCAGTGTGGTATGGG + Intergenic
966807016 3:183815629-183815651 GTCACTTCTCAGTGAAGAAACGG + Intergenic
967169737 3:186813723-186813745 AGCACTTAACAGAGAGGAATGGG - Intergenic
968298553 3:197595727-197595749 CTCACATCACAGGGAGGAAGTGG - Intergenic
969341955 4:6547785-6547807 CTCTCATCTCAGAGAAAAATTGG + Intronic
970078555 4:12253218-12253240 CTCATTTCTTAGAGATGAAGTGG - Intergenic
970935980 4:21570203-21570225 CTAACTTCTCAGAAAAGAGTAGG + Intronic
970974229 4:22024532-22024554 CTCACATGTCAGAAAGGAGTAGG + Intergenic
973239726 4:47944779-47944801 CTGAGTTCTCTGAGAGCAATAGG + Intronic
973294607 4:48503252-48503274 GTTACTTCTCAGAAAAGAATTGG + Intronic
973748079 4:53984239-53984261 CTCACTTTTCTTAGAGAAATAGG - Intronic
974206767 4:58713968-58713990 CTTATTTCTCAGATAGGACTTGG - Intergenic
975543884 4:75541982-75542004 CTCATTTTTCAGAGATGAAATGG - Intronic
978486076 4:109254999-109255021 CTCACCTGTCAGGGATGAATTGG + Intronic
979846929 4:125525283-125525305 TTCACTTCCCAGAGAGGTAGGGG - Intergenic
981003788 4:139854294-139854316 CTCAGTTCTCAGTGAGAAAATGG + Intronic
982479286 4:155889602-155889624 CTCACTTCACAGATGGGAAACGG - Intronic
990880995 5:60539264-60539286 CTGACATCACAGTGAGGAATAGG - Intergenic
992564506 5:77984735-77984757 CACACTTTTCAGAGAGGAGACGG + Intergenic
992810561 5:80383644-80383666 CTCAGGTCACAGAGAGAAATAGG - Intergenic
994591831 5:101783567-101783589 CTCATTTCTCTGTGAGGAAGGGG - Intergenic
996520277 5:124418453-124418475 CTCACTCCTCAGAGGGGCATAGG - Intergenic
997292674 5:132748534-132748556 CTCACCTCTCAAGCAGGAATGGG - Intronic
998449411 5:142222770-142222792 TTCACTTCTCTGAGAGGCATGGG + Intergenic
999042027 5:148424900-148424922 GTCACTTGTCAGAGAGAATTAGG + Intronic
1000015174 5:157269359-157269381 CTGAATTCTCACAGAGGAAGAGG - Intronic
1001145511 5:169180643-169180665 CTCTCTACTCAGGGAGGAACTGG + Intronic
1001484738 5:172111345-172111367 CTCTCTTCTCAGGAAGGGATCGG - Intronic
1001844104 5:174905081-174905103 CTCACTGCGTCGAGAGGAATGGG - Intergenic
1003355562 6:5366399-5366421 GTCACTTCTCAGATAGAAGTGGG + Intronic
1003945528 6:11072029-11072051 CACACTTCTAAGAACGGAATGGG + Intergenic
1004549394 6:16632115-16632137 CTCACTGGCCAGAGAGGAAAAGG - Intronic
1005094110 6:22093782-22093804 CTCATTACACAGACAGGAATGGG - Intergenic
1005243420 6:23855770-23855792 CTCACTTCCCAGAGTGTAAGGGG - Intergenic
1005616978 6:27582923-27582945 CTCTCTTCCCAGAGAGAAAGTGG + Intergenic
1008423535 6:51330738-51330760 CTGACTTCTAAGAAAGGATTTGG - Intergenic
1009398390 6:63228595-63228617 CTCACTTCCCAGAGTGTAAGGGG + Intergenic
1013272341 6:108556856-108556878 TTCACTTCACAGTGAGGAATGGG - Intergenic
1015509645 6:134025238-134025260 CTCAAGTCTAAGACAGGAATAGG - Intronic
1017813068 6:157998067-157998089 CGGTCTGCTCAGAGAGGAATAGG + Intronic
1018176005 6:161180069-161180091 CTGACTACTTAGAGAGGAGTAGG - Intronic
1018482885 6:164209586-164209608 CTTTCCTCTCAGAGAGAAATGGG + Intergenic
1019760528 7:2808986-2809008 CTCAATGCTCAGTGAGGACTGGG + Intronic
1021608254 7:22431362-22431384 TTCACTTCTGAGAGAGCTATTGG - Intronic
1021913355 7:25408037-25408059 TTCTCTTCTCAGAGAGGGACAGG - Intergenic
1022241644 7:28518081-28518103 CTCATTTTACAGAGAGGACTGGG - Intronic
1022375616 7:29807879-29807901 CTCACTTCACAGGGAGGACTGGG + Intronic
1023113867 7:36841337-36841359 CTCACTTCTCAAAGAGCTACTGG + Intergenic
1023698210 7:42868755-42868777 CTCATTTCTCAGAAATGAATAGG + Intergenic
1024254752 7:47532144-47532166 CTCTCATCTCAGAGCGGGATTGG + Intronic
1026445869 7:70484337-70484359 CTGACTTCTAAGAGTGGAAATGG - Intronic
1026704014 7:72674105-72674127 CACACTTCACGGAGAGGAGTGGG - Intronic
1030165852 7:106554228-106554250 CTCACTCCTCACAGAGGAGTTGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032056123 7:128685768-128685790 GACACTTCTCAGAGTGAAATGGG - Intronic
1032533859 7:132644484-132644506 CTCACTCCACAGGGAGCAATTGG + Intronic
1032682358 7:134198149-134198171 CTTACTTCTCAGTGATTAATTGG + Intronic
1034378152 7:150664780-150664802 CTCAGTTCTCAGAGAGCTGTGGG - Intergenic
1035028236 7:155841013-155841035 CTCACCTTTCAGGGAGGAATAGG - Intergenic
1035406408 7:158601183-158601205 CTTACTTCTGGGAGAGGACTGGG - Intergenic
1037175394 8:15941043-15941065 CTAAATTCTCACAGAGGAACAGG + Intergenic
1038329787 8:26599007-26599029 CTCACTTTTCAGAGAAGAGCTGG + Intronic
1041976433 8:63804203-63804225 CTTATTTCTCAGGGTGGAATTGG + Intergenic
1044092614 8:88021061-88021083 CCCAGTTCTCAGACCGGAATCGG - Intergenic
1046176786 8:110585843-110585865 GTTACTACCCAGAGAGGAATGGG + Intergenic
1046376566 8:113389831-113389853 CTCACTTTTCAAAGAGGGAAGGG - Intronic
1046515895 8:115260087-115260109 CTAAATTCTGAGAGAGGAAATGG - Intergenic
1047169688 8:122479847-122479869 CTTCCTTCTCAGGGAGGAAGAGG - Intergenic
1049393541 8:142384276-142384298 CTTCCTTCTCAGAGAGGCAGGGG - Intronic
1050933520 9:11362274-11362296 ATCACTTCTGAGAGGGGACTAGG + Intergenic
1052413571 9:28149665-28149687 CTCACTTCCCAGAGTGTAAGGGG - Intronic
1056019974 9:82431112-82431134 CTCACTTCCCAGAGTGTAAGGGG + Intergenic
1058355722 9:104081638-104081660 CTCATCTCTCAGTGGGGAATGGG + Intergenic
1058502738 9:105637797-105637819 CTCCCTGCTTAGAGAGGACTGGG - Exonic
1058560156 9:106219763-106219785 TTCATTTCTCAGAGATGAATTGG - Intergenic
1058847181 9:108972424-108972446 CTAACTTCTCTGAGAGGATAAGG + Intronic
1060803104 9:126557053-126557075 CTCACTTGGCAGAGAGGAAGTGG + Intergenic
1186355232 X:8783568-8783590 CTCACGTCACACAGAGGAAGGGG - Intergenic
1187131996 X:16512158-16512180 CCAACTTCTCAGCCAGGAATGGG + Intergenic
1188377379 X:29448640-29448662 TTCAGTTCTCAGAGGGAAATGGG + Intronic
1190106940 X:47567580-47567602 CTCATTTCCCAGAGGGGAAAGGG - Intronic
1190222401 X:48520820-48520842 TTCACTGCTCAGAGGGGAATAGG + Intergenic
1191678518 X:63816734-63816756 AGCACCTCTCAGAGAGGGATAGG - Intergenic
1195857305 X:109345132-109345154 CTCACTTCTCAGGGAGGTTAGGG + Intergenic
1196883731 X:120223695-120223717 ATCTCATCTCAGAGAGGAGTTGG - Intergenic
1196925309 X:120628453-120628475 CTCATTTTACAGAGAGGAAATGG + Intronic
1199440313 X:147860316-147860338 ATCTTTTCTCAGAGTGGAATAGG + Intergenic
1199665816 X:150095587-150095609 ATGACTTATCAGAGAGGAAGGGG - Intergenic
1200399464 X:156010645-156010667 CCCACTTCTCAGAGAGGTCAGGG - Intronic