ID: 1090209495

View in Genome Browser
Species Human (GRCh38)
Location 11:124908075-124908097
Sequence AGTCATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090209493_1090209495 1 Left 1090209493 11:124908051-124908073 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG No data
1090209490_1090209495 13 Left 1090209490 11:124908039-124908061 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG No data
1090209491_1090209495 12 Left 1090209491 11:124908040-124908062 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG No data
1090209489_1090209495 19 Left 1090209489 11:124908033-124908055 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG No data
1090209488_1090209495 22 Left 1090209488 11:124908030-124908052 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090209495 Original CRISPR AGTCATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr